\
| Variant ID: vg0609333189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9333189 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )
TCCCCTCATGACAGCAGATCTTCTGGTTTTGCCATCCTCTTTGCTCTAATCTATTCGCCGTCCAAACTCTATTCTGGGAAATAAGCCAAGAGAAGAATTT[A/G]
CATTTCGGCAGCGCCCACTCTTTCTAGATCAATTGATTGAAAGCGGATCTCGCCGCCCCGAGGAATTGGAGTCTGTAGGCCGATCTTGCCAAGTATTGCC
GGCAATACTTGGCAAGATCGGCCTACAGACTCCAATTCCTCGGGGCGGCGAGATCCGCTTTCAATCAATTGATCTAGAAAGAGTGGGCGCTGCCGAAATG[T/C]
AAATTCTTCTCTTGGCTTATTTCCCAGAATAGAGTTTGGACGGCGAATAGATTAGAGCAAAGAGGATGGCAAAACCAGAAGATCTGCTGTCATGAGGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 69.40% | 30.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 43.00% | 57.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609333189 | A -> G | LOC_Os06g16350.1 | upstream_gene_variant ; 4978.0bp to feature; MODIFIER | silent_mutation | Average:59.842; most accessible tissue: Callus, score: 71.274 | N | N | N | N |
| vg0609333189 | A -> G | LOC_Os06g16370.1 | upstream_gene_variant ; 3170.0bp to feature; MODIFIER | silent_mutation | Average:59.842; most accessible tissue: Callus, score: 71.274 | N | N | N | N |
| vg0609333189 | A -> G | LOC_Os06g16360.1 | downstream_gene_variant ; 24.0bp to feature; MODIFIER | silent_mutation | Average:59.842; most accessible tissue: Callus, score: 71.274 | N | N | N | N |
| vg0609333189 | A -> G | LOC_Os06g16350-LOC_Os06g16360 | intergenic_region ; MODIFIER | silent_mutation | Average:59.842; most accessible tissue: Callus, score: 71.274 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609333189 | 1.91E-08 | NA | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609333189 | NA | 2.22E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609333189 | NA | 3.95E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609333189 | NA | 1.68E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609333189 | NA | 1.88E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609333189 | NA | 1.08E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609333189 | NA | 6.89E-12 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609333189 | NA | 6.96E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |