\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609333189:

Variant ID: vg0609333189 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9333189
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCCTCATGACAGCAGATCTTCTGGTTTTGCCATCCTCTTTGCTCTAATCTATTCGCCGTCCAAACTCTATTCTGGGAAATAAGCCAAGAGAAGAATTT[A/G]
CATTTCGGCAGCGCCCACTCTTTCTAGATCAATTGATTGAAAGCGGATCTCGCCGCCCCGAGGAATTGGAGTCTGTAGGCCGATCTTGCCAAGTATTGCC

Reverse complement sequence

GGCAATACTTGGCAAGATCGGCCTACAGACTCCAATTCCTCGGGGCGGCGAGATCCGCTTTCAATCAATTGATCTAGAAAGAGTGGGCGCTGCCGAAATG[T/C]
AAATTCTTCTCTTGGCTTATTTCCCAGAATAGAGTTTGGACGGCGAATAGATTAGAGCAAAGAGGATGGCAAAACCAGAAGATCTGCTGTCATGAGGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 10.00% 0.00% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 69.40% 30.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 43.00% 57.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609333189 A -> G LOC_Os06g16350.1 upstream_gene_variant ; 4978.0bp to feature; MODIFIER silent_mutation Average:59.842; most accessible tissue: Callus, score: 71.274 N N N N
vg0609333189 A -> G LOC_Os06g16370.1 upstream_gene_variant ; 3170.0bp to feature; MODIFIER silent_mutation Average:59.842; most accessible tissue: Callus, score: 71.274 N N N N
vg0609333189 A -> G LOC_Os06g16360.1 downstream_gene_variant ; 24.0bp to feature; MODIFIER silent_mutation Average:59.842; most accessible tissue: Callus, score: 71.274 N N N N
vg0609333189 A -> G LOC_Os06g16350-LOC_Os06g16360 intergenic_region ; MODIFIER silent_mutation Average:59.842; most accessible tissue: Callus, score: 71.274 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609333189 1.91E-08 NA mr1679 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609333189 NA 2.22E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609333189 NA 3.95E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609333189 NA 1.68E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609333189 NA 1.88E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609333189 NA 1.08E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609333189 NA 6.89E-12 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609333189 NA 6.96E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251