\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609332559:

Variant ID: vg0609332559 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9332559
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.10, A: 0.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAATCTTAGCTAAGATTGATGCTATCATTGAGATGGTATTGCGGAAGATTCTTACGTTACACTCGCATCATATTTCCCATGAAACTAGGATCACCATC[G/A,T]
TTTGGAGTGGTCGATGGGGGTTATTGGGGGCTTCAAGCACGAGATTCCACCAAAGCACAGTAGAGTGGCAGTCGTCCCATTTGTTCATTTGTAAGTCACT

Reverse complement sequence

AGTGACTTACAAATGAACAAATGGGACGACTGCCACTCTACTGTGCTTTGGTGGAATCTCGTGCTTGAAGCCCCCAATAACCCCCATCGACCACTCCAAA[C/T,A]
GATGGTGATCCTAGTTTCATGGGAAATATGATGCGAGTGTAACGTAAGAATCTTCCGCAATACCATCTCAATGATAGCATCAATCTTAGCTAAGATTAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.30% 0.17% 0.00% T: 0.04%
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 97.10% 2.40% 0.46% 0.00% NA
Aus  269 12.30% 87.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 95.60% 3.80% 0.65% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 91.10% 5.60% 1.11% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609332559 G -> T LOC_Os06g16350.1 upstream_gene_variant ; 4348.0bp to feature; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0609332559 G -> T LOC_Os06g16370.1 upstream_gene_variant ; 3800.0bp to feature; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0609332559 G -> T LOC_Os06g16360.1 downstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0609332559 G -> T LOC_Os06g16350-LOC_Os06g16360 intergenic_region ; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0609332559 G -> A LOC_Os06g16350.1 upstream_gene_variant ; 4348.0bp to feature; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0609332559 G -> A LOC_Os06g16370.1 upstream_gene_variant ; 3800.0bp to feature; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0609332559 G -> A LOC_Os06g16360.1 downstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0609332559 G -> A LOC_Os06g16350-LOC_Os06g16360 intergenic_region ; MODIFIER silent_mutation Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609332559 NA 8.21E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559 NA 1.27E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559 1.30E-06 NA mr1552 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559 NA 2.26E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559 NA 3.14E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559 NA 5.09E-31 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559 NA 6.17E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251