\
| Variant ID: vg0609332559 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9332559 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.10, A: 0.01, others allele: 0.00, population size: 209. )
CTTAATCTTAGCTAAGATTGATGCTATCATTGAGATGGTATTGCGGAAGATTCTTACGTTACACTCGCATCATATTTCCCATGAAACTAGGATCACCATC[G/A,T]
TTTGGAGTGGTCGATGGGGGTTATTGGGGGCTTCAAGCACGAGATTCCACCAAAGCACAGTAGAGTGGCAGTCGTCCCATTTGTTCATTTGTAAGTCACT
AGTGACTTACAAATGAACAAATGGGACGACTGCCACTCTACTGTGCTTTGGTGGAATCTCGTGCTTGAAGCCCCCAATAACCCCCATCGACCACTCCAAA[C/T,A]
GATGGTGATCCTAGTTTCATGGGAAATATGATGCGAGTGTAACGTAAGAATCTTCCGCAATACCATCTCAATGATAGCATCAATCTTAGCTAAGATTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.30% | 0.17% | 0.00% | T: 0.04% |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.10% | 2.40% | 0.46% | 0.00% | NA |
| Aus | 269 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.60% | 3.80% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 5.60% | 1.11% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609332559 | G -> T | LOC_Os06g16350.1 | upstream_gene_variant ; 4348.0bp to feature; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0609332559 | G -> T | LOC_Os06g16370.1 | upstream_gene_variant ; 3800.0bp to feature; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0609332559 | G -> T | LOC_Os06g16360.1 | downstream_gene_variant ; 654.0bp to feature; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0609332559 | G -> T | LOC_Os06g16350-LOC_Os06g16360 | intergenic_region ; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0609332559 | G -> A | LOC_Os06g16350.1 | upstream_gene_variant ; 4348.0bp to feature; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0609332559 | G -> A | LOC_Os06g16370.1 | upstream_gene_variant ; 3800.0bp to feature; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0609332559 | G -> A | LOC_Os06g16360.1 | downstream_gene_variant ; 654.0bp to feature; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0609332559 | G -> A | LOC_Os06g16350-LOC_Os06g16360 | intergenic_region ; MODIFIER | silent_mutation | Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609332559 | NA | 8.21E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609332559 | NA | 1.27E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609332559 | 1.30E-06 | NA | mr1552 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609332559 | NA | 2.26E-07 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609332559 | NA | 3.14E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609332559 | NA | 5.09E-31 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609332559 | NA | 6.17E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |