Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609250230:

Variant ID: vg0609250230 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9250230
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCTACTATTTGCATATATTGTCAGTTGTAGGATCAAACTGACTGGCACGCCCGCATCTCATCAAGATTTGGACCTGCACTGGAGCTAAGCAGATCTCC[C/T]
AGGCCGGTGTGTTCGATTTTTTCGCCAACAGAGGACAACGTGGTGGCCTCGCCGGCAACTGCCGCCGCCTCATACGGGATGCGGGGGCGTCGCATGGGGC

Reverse complement sequence

GCCCCATGCGACGCCCCCGCATCCCGTATGAGGCGGCGGCAGTTGCCGGCGAGGCCACCACGTTGTCCTCTGTTGGCGAAAAAATCGAACACACCGGCCT[G/A]
GGAGATCTGCTTAGCTCCAGTGCAGGTCCAAATCTTGATGAGATGCGGGCGTGCCAGTCAGTTTGATCCTACAACTGACAATATATGCAAATAGTAGATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.60%	7.20%	0.87%	0.30%	NA
All Indica	2759	85.90%	12.20%	1.45%	0.51%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	91.30%	4.70%	3.03%	1.01%	NA
Indica II	465	98.70%	0.90%	0.22%	0.22%	NA
Indica III	913	78.10%	20.50%	1.10%	0.33%	NA
Indica Intermediate	786	83.20%	14.90%	1.40%	0.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609250230	C -> T	LOC_Os06g16250.1	upstream_gene_variant ; 3494.0bp to feature; MODIFIER	silent_mutation	Average:60.716; most accessible tissue: Callus, score: 96.513	N	N	N	N
vg0609250230	C -> T	LOC_Os06g16240.1	downstream_gene_variant ; 1854.0bp to feature; MODIFIER	silent_mutation	Average:60.716; most accessible tissue: Callus, score: 96.513	N	N	N	N
vg0609250230	C -> T	LOC_Os06g16240-LOC_Os06g16250	intergenic_region ; MODIFIER	silent_mutation	Average:60.716; most accessible tissue: Callus, score: 96.513	N	N	N	N
vg0609250230	C -> DEL	N	N	silent_mutation	Average:60.716; most accessible tissue: Callus, score: 96.513	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609250230	NA	1.33E-07	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	8.70E-06	1.81E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	3.52E-06	1.67E-12	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	NA	8.36E-08	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	NA	6.62E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	NA	5.66E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	7.51E-06	NA	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	NA	1.55E-08	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230	1.75E-06	4.45E-08	mr1570_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251