\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609250230:

Variant ID: vg0609250230 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9250230
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCTACTATTTGCATATATTGTCAGTTGTAGGATCAAACTGACTGGCACGCCCGCATCTCATCAAGATTTGGACCTGCACTGGAGCTAAGCAGATCTCC[C/T]
AGGCCGGTGTGTTCGATTTTTTCGCCAACAGAGGACAACGTGGTGGCCTCGCCGGCAACTGCCGCCGCCTCATACGGGATGCGGGGGCGTCGCATGGGGC

Reverse complement sequence

GCCCCATGCGACGCCCCCGCATCCCGTATGAGGCGGCGGCAGTTGCCGGCGAGGCCACCACGTTGTCCTCTGTTGGCGAAAAAATCGAACACACCGGCCT[G/A]
GGAGATCTGCTTAGCTCCAGTGCAGGTCCAAATCTTGATGAGATGCGGGCGTGCCAGTCAGTTTGATCCTACAACTGACAATATATGCAAATAGTAGATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 7.20% 0.87% 0.30% NA
All Indica  2759 85.90% 12.20% 1.45% 0.51% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 91.30% 4.70% 3.03% 1.01% NA
Indica II  465 98.70% 0.90% 0.22% 0.22% NA
Indica III  913 78.10% 20.50% 1.10% 0.33% NA
Indica Intermediate  786 83.20% 14.90% 1.40% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609250230 C -> T LOC_Os06g16250.1 upstream_gene_variant ; 3494.0bp to feature; MODIFIER silent_mutation Average:60.716; most accessible tissue: Callus, score: 96.513 N N N N
vg0609250230 C -> T LOC_Os06g16240.1 downstream_gene_variant ; 1854.0bp to feature; MODIFIER silent_mutation Average:60.716; most accessible tissue: Callus, score: 96.513 N N N N
vg0609250230 C -> T LOC_Os06g16240-LOC_Os06g16250 intergenic_region ; MODIFIER silent_mutation Average:60.716; most accessible tissue: Callus, score: 96.513 N N N N
vg0609250230 C -> DEL N N silent_mutation Average:60.716; most accessible tissue: Callus, score: 96.513 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609250230 NA 1.33E-07 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 8.70E-06 1.81E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 3.52E-06 1.67E-12 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 NA 8.36E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 NA 6.62E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 NA 5.66E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 7.51E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 NA 1.55E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609250230 1.75E-06 4.45E-08 mr1570_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251