| Variant ID: vg0609250230 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9250230 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATCTACTATTTGCATATATTGTCAGTTGTAGGATCAAACTGACTGGCACGCCCGCATCTCATCAAGATTTGGACCTGCACTGGAGCTAAGCAGATCTCC[C/T]
AGGCCGGTGTGTTCGATTTTTTCGCCAACAGAGGACAACGTGGTGGCCTCGCCGGCAACTGCCGCCGCCTCATACGGGATGCGGGGGCGTCGCATGGGGC
GCCCCATGCGACGCCCCCGCATCCCGTATGAGGCGGCGGCAGTTGCCGGCGAGGCCACCACGTTGTCCTCTGTTGGCGAAAAAATCGAACACACCGGCCT[G/A]
GGAGATCTGCTTAGCTCCAGTGCAGGTCCAAATCTTGATGAGATGCGGGCGTGCCAGTCAGTTTGATCCTACAACTGACAATATATGCAAATAGTAGATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 7.20% | 0.87% | 0.30% | NA |
| All Indica | 2759 | 85.90% | 12.20% | 1.45% | 0.51% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 4.70% | 3.03% | 1.01% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.22% | 0.22% | NA |
| Indica III | 913 | 78.10% | 20.50% | 1.10% | 0.33% | NA |
| Indica Intermediate | 786 | 83.20% | 14.90% | 1.40% | 0.51% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609250230 | C -> T | LOC_Os06g16250.1 | upstream_gene_variant ; 3494.0bp to feature; MODIFIER | silent_mutation | Average:60.716; most accessible tissue: Callus, score: 96.513 | N | N | N | N |
| vg0609250230 | C -> T | LOC_Os06g16240.1 | downstream_gene_variant ; 1854.0bp to feature; MODIFIER | silent_mutation | Average:60.716; most accessible tissue: Callus, score: 96.513 | N | N | N | N |
| vg0609250230 | C -> T | LOC_Os06g16240-LOC_Os06g16250 | intergenic_region ; MODIFIER | silent_mutation | Average:60.716; most accessible tissue: Callus, score: 96.513 | N | N | N | N |
| vg0609250230 | C -> DEL | N | N | silent_mutation | Average:60.716; most accessible tissue: Callus, score: 96.513 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609250230 | NA | 1.33E-07 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | 8.70E-06 | 1.81E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | 3.52E-06 | 1.67E-12 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | NA | 8.36E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | NA | 6.62E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | NA | 5.66E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | 7.51E-06 | NA | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | NA | 1.55E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609250230 | 1.75E-06 | 4.45E-08 | mr1570_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |