\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609225907:

Variant ID: vg0609225907 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9225907
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTGTGATTTCAGTTTGTATGATTGTTATAAATAATTCAAATATGAGCATCCCTTGTGATGTTTTTCAACAAAAAAATAACAAATACTAGCCAAGTACA[A/T]
AATTTGACCAAAATTTGAACAAAATTTCGATAGGTCCGGAAAGTTGCTACTGAAGAATTTCATGACGAAGAAGCTCATCAGTTACGAAAAACAGAGTTCA

Reverse complement sequence

TGAACTCTGTTTTTCGTAACTGATGAGCTTCTTCGTCATGAAATTCTTCAGTAGCAACTTTCCGGACCTATCGAAATTTTGTTCAAATTTTGGTCAAATT[T/A]
TGTACTTGGCTAGTATTTGTTATTTTTTTGTTGAAAAACATCACAAGGGATGCTCATATTTGAATTATTTATAACAATCATACAAACTGAAATCACACGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.40% 26.70% 0.21% 43.65% NA
All Indica  2759 12.00% 14.40% 0.33% 73.32% NA
All Japonica  1512 60.40% 39.00% 0.00% 0.66% NA
Aus  269 6.70% 92.90% 0.00% 0.37% NA
Indica I  595 4.20% 7.40% 0.50% 87.90% NA
Indica II  465 17.80% 2.60% 0.00% 79.57% NA
Indica III  913 14.10% 21.40% 0.11% 64.40% NA
Indica Intermediate  786 11.80% 18.60% 0.64% 68.96% NA
Temperate Japonica  767 27.10% 72.20% 0.00% 0.65% NA
Tropical Japonica  504 97.80% 1.60% 0.00% 0.60% NA
Japonica Intermediate  241 88.00% 11.20% 0.00% 0.83% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 45.60% 21.10% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609225907 A -> T LOC_Os06g16200.1 downstream_gene_variant ; 2257.0bp to feature; MODIFIER silent_mutation Average:11.446; most accessible tissue: Callus, score: 65.289 N N N N
vg0609225907 A -> T LOC_Os06g16210.1 downstream_gene_variant ; 3961.0bp to feature; MODIFIER silent_mutation Average:11.446; most accessible tissue: Callus, score: 65.289 N N N N
vg0609225907 A -> T LOC_Os06g16200-LOC_Os06g16210 intergenic_region ; MODIFIER silent_mutation Average:11.446; most accessible tissue: Callus, score: 65.289 N N N N
vg0609225907 A -> DEL N N silent_mutation Average:11.446; most accessible tissue: Callus, score: 65.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609225907 NA 3.03E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0609225907 NA 5.20E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0609225907 NA 4.36E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 5.00E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 2.82E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 2.57E-06 NA mr1570 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 9.06E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 5.43E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 8.74E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 8.40E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 1.62E-10 NA mr1087_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 8.74E-06 7.93E-14 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 5.13E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 4.72E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 3.91E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 2.06E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 5.27E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 6.18E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 1.55E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 3.22E-10 2.33E-18 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225907 NA 6.97E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251