\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609225638:

Variant ID: vg0609225638 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9225638
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAGTCCCAGAGGCAAGATATGGTTGCTTCCTTATTCTTTTCTTTTCTTCATTGTTTTAATATAGTGACAATTGCATCTATGCCCCCACTTTCAAAC[C/T]
CAATTGTTGTTTTACCCTCACTTTTTAGGGTTTGCAATTTTACCCTCACTTTTTGAATCTGAAACTGCTGGCTACCCCCACTTCTAATAGTCGGTTTAAC

Reverse complement sequence

GTTAAACCGACTATTAGAAGTGGGGGTAGCCAGCAGTTTCAGATTCAAAAAGTGAGGGTAAAATTGCAAACCCTAAAAAGTGAGGGTAAAACAACAATTG[G/A]
GTTTGAAAGTGGGGGCATAGATGCAATTGTCACTATATTAAAACAATGAAGAAAAGAAAAGAATAAGGAAGCAACCATATCTTGCCTCTGGGACTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 15.50% 0.80% 43.53% NA
All Indica  2759 18.70% 7.50% 0.65% 73.11% NA
All Japonica  1512 65.30% 33.00% 1.06% 0.66% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 10.40% 0.30% 1.18% 88.07% NA
Indica II  465 4.10% 15.70% 0.43% 79.78% NA
Indica III  913 30.70% 5.30% 0.11% 63.96% NA
Indica Intermediate  786 19.70% 10.80% 1.02% 68.45% NA
Temperate Japonica  767 91.30% 7.30% 0.78% 0.65% NA
Tropical Japonica  504 18.80% 79.20% 1.39% 0.60% NA
Japonica Intermediate  241 79.70% 18.30% 1.24% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 36.70% 27.80% 3.33% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609225638 C -> T LOC_Os06g16200.1 downstream_gene_variant ; 1988.0bp to feature; MODIFIER silent_mutation Average:10.501; most accessible tissue: Callus, score: 58.487 N N N N
vg0609225638 C -> T LOC_Os06g16210.1 downstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:10.501; most accessible tissue: Callus, score: 58.487 N N N N
vg0609225638 C -> T LOC_Os06g16200-LOC_Os06g16210 intergenic_region ; MODIFIER silent_mutation Average:10.501; most accessible tissue: Callus, score: 58.487 N N N N
vg0609225638 C -> DEL N N silent_mutation Average:10.501; most accessible tissue: Callus, score: 58.487 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609225638 NA 9.05E-12 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 6.30E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 1.52E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 1.84E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 4.04E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 2.00E-11 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 9.40E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 2.75E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 3.63E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 6.23E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 1.10E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 1.15E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 3.88E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 1.55E-06 3.03E-11 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 2.68E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 1.47E-06 NA mr1121_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 6.13E-09 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 3.72E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 2.43E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 5.84E-06 1.43E-12 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 3.00E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 1.18E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 3.22E-18 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 2.31E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638 NA 9.88E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251