Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609225638:

Variant ID: vg0609225638 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9225638
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTAGTCCCAGAGGCAAGATATGGTTGCTTCCTTATTCTTTTCTTTTCTTCATTGTTTTAATATAGTGACAATTGCATCTATGCCCCCACTTTCAAAC[C/T]
CAATTGTTGTTTTACCCTCACTTTTTAGGGTTTGCAATTTTACCCTCACTTTTTGAATCTGAAACTGCTGGCTACCCCCACTTCTAATAGTCGGTTTAAC

Reverse complement sequence

GTTAAACCGACTATTAGAAGTGGGGGTAGCCAGCAGTTTCAGATTCAAAAAGTGAGGGTAAAATTGCAAACCCTAAAAAGTGAGGGTAAAACAACAATTG[G/A]
GTTTGAAAGTGGGGGCATAGATGCAATTGTCACTATATTAAAACAATGAAGAAAAGAAAAGAATAAGGAAGCAACCATATCTTGCCTCTGGGACTAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.20%	15.50%	0.80%	43.53%	NA
All Indica	2759	18.70%	7.50%	0.65%	73.11%	NA
All Japonica	1512	65.30%	33.00%	1.06%	0.66%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	10.40%	0.30%	1.18%	88.07%	NA
Indica II	465	4.10%	15.70%	0.43%	79.78%	NA
Indica III	913	30.70%	5.30%	0.11%	63.96%	NA
Indica Intermediate	786	19.70%	10.80%	1.02%	68.45%	NA
Temperate Japonica	767	91.30%	7.30%	0.78%	0.65%	NA
Tropical Japonica	504	18.80%	79.20%	1.39%	0.60%	NA
Japonica Intermediate	241	79.70%	18.30%	1.24%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	36.70%	27.80%	3.33%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609225638	C -> T	LOC_Os06g16200.1	downstream_gene_variant ; 1988.0bp to feature; MODIFIER	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 58.487	N	N	N	N
vg0609225638	C -> T	LOC_Os06g16210.1	downstream_gene_variant ; 4230.0bp to feature; MODIFIER	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 58.487	N	N	N	N
vg0609225638	C -> T	LOC_Os06g16200-LOC_Os06g16210	intergenic_region ; MODIFIER	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 58.487	N	N	N	N
vg0609225638	C -> DEL	N	N	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 58.487	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609225638	NA	9.05E-12	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	6.30E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	1.52E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	1.84E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	4.04E-07	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	2.00E-11	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	9.40E-08	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	2.75E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	3.63E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	6.23E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	1.10E-12	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	1.15E-09	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	3.88E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	1.55E-06	3.03E-11	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	2.68E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	1.47E-06	NA	mr1121_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	6.13E-09	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	3.72E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	2.43E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	5.84E-06	1.43E-12	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	3.00E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	1.18E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	3.22E-18	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	2.31E-12	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609225638	NA	9.88E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251