\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609221063:

Variant ID: vg0609221063 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9221063
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATAGTATCCTAATCTGCTTCTAAATCAATAAGATTAGCCATGTAGTGTCCTTTCCGCCTTCCTCCACATGCACCATACAATTTCATACACTAAAACGA[G/A]
TATTTTACAAGTTTATGCACTAAATTACACTCACCTAACAAATACAATTTACTCTACTATAATACTCACTTGACCATCAATCTAATCATGACTTTGAGTC

Reverse complement sequence

GACTCAAAGTCATGATTAGATTGATGGTCAAGTGAGTATTATAGTAGAGTAAATTGTATTTGTTAGGTGAGTGTAATTTAGTGCATAAACTTGTAAAATA[C/T]
TCGTTTTAGTGTATGAAATTGTATGGTGCATGTGGAGGAAGGCGGAAAGGACACTACATGGCTAATCTTATTGATTTAGAAGCAGATTAGGATACTATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 7.90% 1.44% 43.36% NA
All Indica  2759 26.40% 0.30% 0.47% 72.82% NA
All Japonica  1512 72.20% 23.60% 3.51% 0.73% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 11.10% 0.20% 1.34% 87.39% NA
Indica II  465 21.10% 0.60% 0.00% 78.28% NA
Indica III  913 35.60% 0.00% 0.22% 64.18% NA
Indica Intermediate  786 30.50% 0.50% 0.38% 68.58% NA
Temperate Japonica  767 47.60% 44.70% 6.91% 0.78% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 93.40% 5.80% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 58.90% 7.80% 2.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609221063 G -> A LOC_Os06g16200.1 upstream_gene_variant ; 263.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N
vg0609221063 G -> A LOC_Os06g16190.1 downstream_gene_variant ; 1194.0bp to feature; MODIFIER silent_mutation Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N
vg0609221063 G -> A LOC_Os06g16190-LOC_Os06g16200 intergenic_region ; MODIFIER silent_mutation Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N
vg0609221063 G -> DEL N N silent_mutation Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0609221063 G A -0.02 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609221063 NA 1.37E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 7.26E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 2.88E-06 3.34E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 3.60E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 2.68E-13 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 1.62E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 6.61E-11 6.37E-40 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 2.70E-06 5.41E-14 mr1137_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 4.82E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 7.00E-09 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 9.85E-08 7.28E-27 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 7.17E-10 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 3.82E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063 NA 4.95E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251