\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609219049:

Variant ID: vg0609219049 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9219049
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAGCGCCTACGTGTGGCTAATTTGACTCGGTCTTCATCTGACGTGGCGCTTACATGGCAATTCGATCCAAAAAATAATAAAACTTATGGGACCCACAT[G/A]
TCAGTTTCACACACAATAATAAAAAAATGGTGGGGTCAACGTGGGCCCCACCTGTCATTCTCAATCCCTTCCTCTTCTTCCCCTCTCTCTATATCTCCCC

Reverse complement sequence

GGGGAGATATAGAGAGAGGGGAAGAAGAGGAAGGGATTGAGAATGACAGGTGGGGCCCACGTTGACCCCACCATTTTTTTATTATTGTGTGTGAAACTGA[C/T]
ATGTGGGTCCCATAAGTTTTATTATTTTTTGGATCGAATTGCCATGTAAGCGCCACGTCAGATGAAGACCGAGTCAAATTAGCCACACGTAGGCGCTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 45.50% 0.38% 0.25% NA
All Indica  2759 24.40% 74.90% 0.29% 0.40% NA
All Japonica  1512 96.10% 3.30% 0.60% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 9.70% 89.60% 0.50% 0.17% NA
Indica II  465 18.10% 81.10% 0.00% 0.86% NA
Indica III  913 33.80% 65.60% 0.33% 0.22% NA
Indica Intermediate  786 28.40% 70.90% 0.25% 0.51% NA
Temperate Japonica  767 99.00% 0.80% 0.26% 0.00% NA
Tropical Japonica  504 91.10% 7.70% 1.19% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609219049 G -> A LOC_Os06g16180.1 upstream_gene_variant ; 3452.0bp to feature; MODIFIER silent_mutation Average:93.532; most accessible tissue: Zhenshan97 root, score: 96.419 N N N N
vg0609219049 G -> A LOC_Os06g16190.1 upstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:93.532; most accessible tissue: Zhenshan97 root, score: 96.419 N N N N
vg0609219049 G -> A LOC_Os06g16200.1 upstream_gene_variant ; 2277.0bp to feature; MODIFIER silent_mutation Average:93.532; most accessible tissue: Zhenshan97 root, score: 96.419 N N N N
vg0609219049 G -> A LOC_Os06g16180-LOC_Os06g16190 intergenic_region ; MODIFIER silent_mutation Average:93.532; most accessible tissue: Zhenshan97 root, score: 96.419 N N N N
vg0609219049 G -> DEL N N silent_mutation Average:93.532; most accessible tissue: Zhenshan97 root, score: 96.419 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0609219049 G A -0.02 -0.03 -0.02 -0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609219049 NA 2.26E-44 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 4.06E-37 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 4.02E-16 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 2.47E-32 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 1.38E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 4.85E-25 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 8.84E-23 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 2.10E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 9.80E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 2.24E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 8.65E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 5.34E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 5.16E-52 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 4.87E-57 mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 4.08E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 1.34E-60 mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 8.27E-06 mr1197_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 9.53E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 3.71E-20 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 1.54E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 2.46E-62 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 5.20E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 7.94E-17 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 1.11E-06 9.60E-18 mr1850_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 1.27E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 2.20E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 7.16E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609219049 NA 7.16E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251