\
| Variant ID: vg0609215660 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9215660 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 65. )
GTCCCCTCTCCTCCTAGGGGGTCTTGTATTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAGACCAATATGGATACAAGTCCTTGTCGTTTC[C/T]
ATGTAGAATTCTATTCATCCTTCCTTATGCGAAACTCCTTCTATATACGAAGGTTGTATTCGTATAAAACATAGTATGTGGTGGGTCCTGCCGAGATTTA
TAAATCTCGGCAGGACCCACCACATACTATGTTTTATACGAATACAACCTTCGTATATAGAAGGAGTTTCGCATAAGGAAGGATGAATAGAATTCTACAT[G/A]
GAAACGACAAGGACTTGTATCCATATTGGTCTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAATACAAGACCCCCTAGGAGGAGAGGGGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 7.30% | 2.45% | 41.39% | NA |
| All Indica | 2759 | 14.10% | 12.30% | 4.02% | 69.59% | NA |
| All Japonica | 1512 | 99.20% | 0.10% | 0.13% | 0.60% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 5.70% | 4.90% | 4.54% | 84.87% | NA |
| Indica II | 465 | 19.60% | 1.10% | 4.09% | 75.27% | NA |
| Indica III | 913 | 14.90% | 20.80% | 3.18% | 61.12% | NA |
| Indica Intermediate | 786 | 16.20% | 14.80% | 4.58% | 64.50% | NA |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.26% | 0.52% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 2.20% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609215660 | C -> T | LOC_Os06g16180.1 | upstream_gene_variant ; 63.0bp to feature; MODIFIER | silent_mutation | Average:27.422; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0609215660 | C -> T | LOC_Os06g16190.1 | upstream_gene_variant ; 4000.0bp to feature; MODIFIER | silent_mutation | Average:27.422; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0609215660 | C -> T | LOC_Os06g16180-LOC_Os06g16190 | intergenic_region ; MODIFIER | silent_mutation | Average:27.422; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0609215660 | C -> DEL | N | N | silent_mutation | Average:27.422; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609215660 | 3.36E-06 | 4.41E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609215660 | 1.37E-06 | 9.28E-12 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609215660 | NA | 4.03E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609215660 | NA | 4.80E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609215660 | 5.98E-06 | NA | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609215660 | NA | 1.55E-06 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609215660 | 5.54E-07 | NA | mr1234_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609215660 | NA | 4.41E-07 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |