\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609213350:

Variant ID: vg0609213350 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9213350
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAAAAATTCATAACAAATATTTAGTAATTTATTCCTTATTGATTTTCACATCACAAATAATTTACACATAAAACATTTCTAGCTTTTAACAATATA[C/T]
CAAGGACAATAAATTAATTTCTACAATTACTAACGGTCAAATTAATGGTCAACTAACGGAATGGGTATATAAGGGATCGGAATAAAAACTCAGGGGTATA

Reverse complement sequence

TATACCCCTGAGTTTTTATTCCGATCCCTTATATACCCATTCCGTTAGTTGACCATTAATTTGACCGTTAGTAATTGTAGAAATTAATTTATTGTCCTTG[G/A]
TATATTGTTAAAAGCTAGAAATGTTTTATGTGTAAATTATTTGTGATGTGAAAATCAATAAGGAATAAATTACTAAATATTTGTTATGAATTTTTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 1.50% 1.25% 7.77% NA
All Indica  2759 97.80% 0.00% 0.58% 1.59% NA
All Japonica  1512 73.30% 4.60% 2.58% 19.44% NA
Aus  269 94.10% 0.00% 0.37% 5.58% NA
Indica I  595 97.00% 0.00% 0.50% 2.52% NA
Indica II  465 97.40% 0.00% 0.86% 1.72% NA
Indica III  913 98.60% 0.10% 0.22% 1.10% NA
Indica Intermediate  786 97.70% 0.00% 0.89% 1.40% NA
Temperate Japonica  767 79.30% 2.00% 1.96% 16.82% NA
Tropical Japonica  504 67.30% 9.70% 3.37% 19.64% NA
Japonica Intermediate  241 67.20% 2.50% 2.90% 27.39% NA
VI/Aromatic  96 87.50% 0.00% 1.04% 11.46% NA
Intermediate  90 92.20% 2.20% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609213350 C -> T LOC_Os06g16170.1 upstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:60.854; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0609213350 C -> T LOC_Os06g16180.1 downstream_gene_variant ; 1978.0bp to feature; MODIFIER silent_mutation Average:60.854; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0609213350 C -> T LOC_Os06g16170-LOC_Os06g16180 intergenic_region ; MODIFIER silent_mutation Average:60.854; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0609213350 C -> DEL N N silent_mutation Average:60.854; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609213350 NA 1.86E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 1.79E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 3.89E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 1.15E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 3.64E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 9.77E-07 9.77E-07 mr1424_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 1.81E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 1.19E-08 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 9.60E-07 9.59E-07 mr1562_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 1.40E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 5.42E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 1.66E-07 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 3.16E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 7.98E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 1.45E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 4.87E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 4.69E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 4.65E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609213350 NA 2.72E-07 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251