\
| Variant ID: vg0609211711 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9211711 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.19, others allele: 0.00, population size: 113. )
TATATGGACTCTATACTCTTCTTTCAATATTCTTTATTTTTTAATTTCGAATTCAGTTATTTATAAATTATATTTCTATATGGATTCTAGTCTACTCTTC[C/T]
AATATTCCTTATTTTTTAATTCTGAATTTCTATTATTTCTTAATTGTATTTCTATATGGACTCTATACTCTTCTTCTAATATTATTTATTTTTTAATTTC
GAAATTAAAAAATAAATAATATTAGAAGAAGAGTATAGAGTCCATATAGAAATACAATTAAGAAATAATAGAAATTCAGAATTAAAAAATAAGGAATATT[G/A]
GAAGAGTAGACTAGAATCCATATAGAAATATAATTTATAAATAACTGAATTCGAAATTAAAAAATAAAGAATATTGAAAGAAGAGTATAGAGTCCATATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 10.40% | 2.48% | 0.02% | NA |
| All Indica | 2759 | 87.60% | 12.20% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 7.80% | 54.60% | 37.17% | 0.37% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 15.50% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 3.10% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609211711 | C -> T | LOC_Os06g16170.1 | upstream_gene_variant ; 2198.0bp to feature; MODIFIER | silent_mutation | Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0609211711 | C -> T | LOC_Os06g16180.1 | downstream_gene_variant ; 3617.0bp to feature; MODIFIER | silent_mutation | Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0609211711 | C -> T | LOC_Os06g16170-LOC_Os06g16180 | intergenic_region ; MODIFIER | silent_mutation | Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0609211711 | C -> DEL | N | N | silent_mutation | Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609211711 | NA | 6.17E-15 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 1.10E-17 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 6.70E-21 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 4.34E-22 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 1.72E-20 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 2.31E-08 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | 8.23E-06 | 2.41E-11 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 7.24E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | 5.00E-06 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 5.97E-29 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | 1.10E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | 1.04E-06 | NA | mr1112_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | 8.37E-07 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | 4.52E-06 | NA | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 2.36E-19 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 9.68E-23 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | 8.59E-06 | 1.71E-07 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 1.64E-06 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 4.72E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609211711 | NA | 9.82E-16 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |