\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609211711:

Variant ID: vg0609211711 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9211711
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.19, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TATATGGACTCTATACTCTTCTTTCAATATTCTTTATTTTTTAATTTCGAATTCAGTTATTTATAAATTATATTTCTATATGGATTCTAGTCTACTCTTC[C/T]
AATATTCCTTATTTTTTAATTCTGAATTTCTATTATTTCTTAATTGTATTTCTATATGGACTCTATACTCTTCTTCTAATATTATTTATTTTTTAATTTC

Reverse complement sequence

GAAATTAAAAAATAAATAATATTAGAAGAAGAGTATAGAGTCCATATAGAAATACAATTAAGAAATAATAGAAATTCAGAATTAAAAAATAAGGAATATT[G/A]
GAAGAGTAGACTAGAATCCATATAGAAATATAATTTATAAATAACTGAATTCGAAATTAAAAAATAAAGAATATTGAAAGAAGAGTATAGAGTCCATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 10.40% 2.48% 0.02% NA
All Indica  2759 87.60% 12.20% 0.25% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 7.80% 54.60% 37.17% 0.37% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 79.80% 20.20% 0.00% 0.00% NA
Indica Intermediate  786 83.60% 15.50% 0.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 3.10% 4.17% 0.00% NA
Intermediate  90 92.20% 3.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609211711 C -> T LOC_Os06g16170.1 upstream_gene_variant ; 2198.0bp to feature; MODIFIER silent_mutation Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0609211711 C -> T LOC_Os06g16180.1 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0609211711 C -> T LOC_Os06g16170-LOC_Os06g16180 intergenic_region ; MODIFIER silent_mutation Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0609211711 C -> DEL N N silent_mutation Average:25.685; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609211711 NA 6.17E-15 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 1.10E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 6.70E-21 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 4.34E-22 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 1.72E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 2.31E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 8.23E-06 2.41E-11 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 7.24E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 5.00E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 5.97E-29 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 1.10E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 1.04E-06 NA mr1112_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 8.37E-07 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 4.52E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 2.36E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 9.68E-23 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 8.59E-06 1.71E-07 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 1.64E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 4.72E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609211711 NA 9.82E-16 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251