\
| Variant ID: vg0609207468 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9207468 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.27, others allele: 0.00, population size: 200. )
ACTATTTAAATGGTTTGCAGACAAATGATGGGAGCCATGTTTGGATAATAGGTTTGGGATATGATTTCCCATCCTTGAAAGGATAAGTTTCAATTTTAGC[T/C]
ATCCATTCTTCTCACTCCATTTCATCATGTTCCTCCATTCATTTCCATTTTCCAATCCCACCTCTCGTAACTCATTATCCAAACACACCCTTAAGGTTTA
TAAACCTTAAGGGTGTGTTTGGATAATGAGTTACGAGAGGTGGGATTGGAAAATGGAAATGAATGGAGGAACATGATGAAATGGAGTGAGAAGAATGGAT[A/G]
GCTAAAATTGAAACTTATCCTTTCAAGGATGGGAAATCATATCCCAAACCTATTATCCAAACATGGCTCCCATCATTTGTCTGCAAACCATTTAAATAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 13.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 7.40% | 92.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.50% | 20.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609207468 | T -> C | LOC_Os06g16160.1 | upstream_gene_variant ; 1002.0bp to feature; MODIFIER | silent_mutation | Average:56.25; most accessible tissue: Minghui63 root, score: 86.877 | N | N | N | N |
| vg0609207468 | T -> C | LOC_Os06g16170.1 | downstream_gene_variant ; 282.0bp to feature; MODIFIER | silent_mutation | Average:56.25; most accessible tissue: Minghui63 root, score: 86.877 | N | N | N | N |
| vg0609207468 | T -> C | LOC_Os06g16160-LOC_Os06g16170 | intergenic_region ; MODIFIER | silent_mutation | Average:56.25; most accessible tissue: Minghui63 root, score: 86.877 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609207468 | NA | 3.71E-20 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | NA | 7.35E-14 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | NA | 2.31E-08 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | 8.23E-06 | 2.41E-11 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | NA | 7.24E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | 6.03E-06 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | 2.40E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | 1.52E-06 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | 4.03E-07 | NA | mr1234_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | 4.52E-06 | NA | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | NA | 9.83E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | 8.59E-06 | 1.71E-07 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | NA | 2.41E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609207468 | NA | 7.57E-15 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |