\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609207468:

Variant ID: vg0609207468 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9207468
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.27, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATTTAAATGGTTTGCAGACAAATGATGGGAGCCATGTTTGGATAATAGGTTTGGGATATGATTTCCCATCCTTGAAAGGATAAGTTTCAATTTTAGC[T/C]
ATCCATTCTTCTCACTCCATTTCATCATGTTCCTCCATTCATTTCCATTTTCCAATCCCACCTCTCGTAACTCATTATCCAAACACACCCTTAAGGTTTA

Reverse complement sequence

TAAACCTTAAGGGTGTGTTTGGATAATGAGTTACGAGAGGTGGGATTGGAAAATGGAAATGAATGGAGGAACATGATGAAATGGAGTGAGAAGAATGGAT[A/G]
GCTAAAATTGAAACTTATCCTTTCAAGGATGGGAAATCATATCCCAAACCTATTATCCAAACATGGCTCCCATCATTTGTCTGCAAACCATTTAAATAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 13.00% 0.04% 0.00% NA
All Indica  2759 87.40% 12.60% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 7.40% 92.20% 0.37% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 79.50% 20.50% 0.00% 0.00% NA
Indica Intermediate  786 83.30% 16.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609207468 T -> C LOC_Os06g16160.1 upstream_gene_variant ; 1002.0bp to feature; MODIFIER silent_mutation Average:56.25; most accessible tissue: Minghui63 root, score: 86.877 N N N N
vg0609207468 T -> C LOC_Os06g16170.1 downstream_gene_variant ; 282.0bp to feature; MODIFIER silent_mutation Average:56.25; most accessible tissue: Minghui63 root, score: 86.877 N N N N
vg0609207468 T -> C LOC_Os06g16160-LOC_Os06g16170 intergenic_region ; MODIFIER silent_mutation Average:56.25; most accessible tissue: Minghui63 root, score: 86.877 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609207468 NA 3.71E-20 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 NA 7.35E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 NA 2.31E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 8.23E-06 2.41E-11 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 NA 7.24E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 6.03E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 2.40E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 1.52E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 4.03E-07 NA mr1234_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 4.52E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 NA 9.83E-18 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 8.59E-06 1.71E-07 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 NA 2.41E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609207468 NA 7.57E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251