\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609205986:

Variant ID: vg0609205986 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9205986
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTACTGTAGCAAATCCGGCACGTTTTTCACTTTTTTACCCTGGTCAGTAGACAGATGAGGGAGTTCATGTGGTTCCTGGCAAGGGAATCCCCAATGAAG[G/A]
CCAAGGTCTTCCCCCTCATGGAGGAGAGGAAGCGCGCCGGGTCGAGACGGGGGAGATCACAACTGTCGGGACGCCACCGCCACTGCACGAAGCCAAGGTC

Reverse complement sequence

GACCTTGGCTTCGTGCAGTGGCGGTGGCGTCCCGACAGTTGTGATCTCCCCCGTCTCGACCCGGCGCGCTTCCTCTCCTCCATGAGGGGGAAGACCTTGG[C/T]
CTTCATTGGGGATTCCCTTGCCAGGAACCACATGAACTCCCTCATCTGTCTACTGACCAGGGTAAAAAAGTGAAAAACGTGCCGGATTTGCTACAGTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 28.30% 0.17% 0.00% NA
All Indica  2759 89.00% 11.00% 0.00% 0.00% NA
All Japonica  1512 40.30% 59.30% 0.46% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 83.40% 16.60% 0.00% 0.00% NA
Indica III  913 86.70% 13.30% 0.00% 0.00% NA
Indica Intermediate  786 89.40% 10.60% 0.00% 0.00% NA
Temperate Japonica  767 73.40% 26.50% 0.13% 0.00% NA
Tropical Japonica  504 3.20% 96.60% 0.20% 0.00% NA
Japonica Intermediate  241 12.40% 85.50% 2.07% 0.00% NA
VI/Aromatic  96 10.40% 88.50% 1.04% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609205986 G -> A LOC_Os06g16160.1 missense_variant ; p.Ala141Val; MODERATE nonsynonymous_codon ; A141V Average:75.227; most accessible tissue: Zhenshan97 panicle, score: 94.949 benign 0.347 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0609205986 G A -0.04 -0.04 -0.03 -0.05 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609205986 NA 1.38E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609205986 NA 4.72E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609205986 3.17E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609205986 2.28E-06 2.12E-13 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609205986 NA 2.02E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609205986 NA 3.13E-11 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609205986 1.87E-10 5.56E-17 mr1570_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251