Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0609171483:

Variant ID: vg0609171483 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9171483
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CGATCGAGTAGGTGATCGTGGGACACCCCGAATCTTTCTTCTTTTCCGGGAGCTTGTGGAGTATAACGTTGCTGCATTGTTTCGTCAGCTTGACTACCTC[C/T]
GTTGTTGGGAGCGGTCTCTTGTTGTTGAGTATGTCCTTGAGATAACGGGCGTATGTTGGCACTTGCATGGCGTCCAACAACGGCACGTTGATGTGGATTT

Reverse complement sequence

AAATCCACATCAACGTGCCGTTGTTGGACGCCATGCAAGTGCCAACATACGCCCGTTATCTCAAGGACATACTCAACAACAAGAGACCGCTCCCAACAAC[G/A]
GAGGTAGTCAAGCTGACGAAACAATGCAGCAACGTTATACTCCACAAGCTCCCGGAAAAGAAGAAAGATTCGGGGTGTCCCACGATCACCTACTCGATCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.40%	19.60%	8.87%	49.09%	NA
All Indica	2759	37.50%	8.40%	11.60%	42.55%	NA
All Japonica	1512	0.50%	43.70%	4.56%	51.32%	NA
Aus	269	0.40%	1.50%	4.83%	93.31%	NA
Indica I	595	24.90%	7.20%	7.73%	60.17%	NA
Indica II	465	37.20%	9.00%	10.75%	43.01%	NA
Indica III	913	46.80%	7.80%	14.13%	31.33%	NA
Indica Intermediate	786	36.40%	9.50%	12.09%	41.98%	NA
Temperate Japonica	767	0.30%	73.80%	0.52%	25.42%	NA
Tropical Japonica	504	0.20%	12.50%	10.32%	76.98%	NA
Japonica Intermediate	241	1.70%	12.90%	5.39%	80.08%	NA
VI/Aromatic	96	3.10%	11.50%	5.21%	80.21%	NA
Intermediate	90	16.70%	23.30%	13.33%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609171483	C -> T	LOC_Os06g16100.1	synonymous_variant ; p.Thr417Thr; LOW	synonymous_codon	Average:15.317; most accessible tissue: Callus, score: 29.559	N	N	N	N
vg0609171483	C -> DEL	LOC_Os06g16100.1	N	frameshift_variant	Average:15.317; most accessible tissue: Callus, score: 29.559	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609171483	NA	1.04E-06	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	NA	8.36E-07	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	NA	2.64E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	4.35E-07	NA	mr1109_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	7.19E-06	2.11E-09	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	NA	2.47E-07	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	5.77E-06	NA	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	7.90E-06	4.68E-08	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609171483	NA	1.47E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251