Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609117647:

Variant ID: vg0609117647 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9117647
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TATGCCAATTTGTTGCAGACTTATTTTTTCTTAGTAAATTTCTTAAACCCCCACCTATTATGGTCCAAATTATATAAAACTACACGGATTTTGGTACATG[G/A]
CACATAACGCTAAGTATTATGGTAGTAAAGTTTCATAAAAACTACCCTGCAGTGGCGTATAGCTAGCTAGGTGGCACTGTGGTCCATGTACCACCTAAAA

Reverse complement sequence

TTTTAGGTGGTACATGGACCACAGTGCCACCTAGCTAGCTATACGCCACTGCAGGGTAGTTTTTATGAAACTTTACTACCATAATACTTAGCGTTATGTG[C/T]
CATGTACCAAAATCCGTGTAGTTTTATATAATTTGGACCATAATAGGTGGGGGTTTAAGAAATTTACTAAGAAAAAATAAGTCTGCAACAAATTGGCATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	36.90%	0.44%	0.00%	NA
All Indica	2759	67.50%	32.00%	0.54%	0.00%	NA
All Japonica	1512	61.30%	38.60%	0.07%	0.00%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	58.50%	40.70%	0.84%	0.00%	NA
Indica II	465	94.20%	5.60%	0.22%	0.00%	NA
Indica III	913	55.10%	44.60%	0.33%	0.00%	NA
Indica Intermediate	786	72.90%	26.30%	0.76%	0.00%	NA
Temperate Japonica	767	28.30%	71.60%	0.13%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	11.20%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	8.30%	2.08%	0.00%	NA
Intermediate	90	74.40%	22.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609117647	G -> A	LOC_Os06g16020.1	upstream_gene_variant ; 2220.0bp to feature; MODIFIER	silent_mutation	Average:76.982; most accessible tissue: Minghui63 root, score: 92.505	N	N	N	N
vg0609117647	G -> A	LOC_Os06g16010.1	downstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:76.982; most accessible tissue: Minghui63 root, score: 92.505	N	N	N	N
vg0609117647	G -> A	LOC_Os06g16030.1	intron_variant ; MODIFIER	silent_mutation	Average:76.982; most accessible tissue: Minghui63 root, score: 92.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609117647	NA	5.20E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0609117647	NA	4.36E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	5.00E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	1.01E-06	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	5.19E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	3.94E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	7.84E-10	3.96E-12	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	9.44E-08	2.42E-11	mr1570	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	9.06E-10	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	9.91E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	1.62E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	2.63E-07	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	8.74E-06	7.93E-14	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	4.72E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	2.06E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	1.55E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	8.56E-08	2.15E-11	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	3.22E-10	2.33E-18	mr1570_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647	NA	6.49E-06	mr1668_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251