\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609117647:

Variant ID: vg0609117647 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9117647
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCCAATTTGTTGCAGACTTATTTTTTCTTAGTAAATTTCTTAAACCCCCACCTATTATGGTCCAAATTATATAAAACTACACGGATTTTGGTACATG[G/A]
CACATAACGCTAAGTATTATGGTAGTAAAGTTTCATAAAAACTACCCTGCAGTGGCGTATAGCTAGCTAGGTGGCACTGTGGTCCATGTACCACCTAAAA

Reverse complement sequence

TTTTAGGTGGTACATGGACCACAGTGCCACCTAGCTAGCTATACGCCACTGCAGGGTAGTTTTTATGAAACTTTACTACCATAATACTTAGCGTTATGTG[C/T]
CATGTACCAAAATCCGTGTAGTTTTATATAATTTGGACCATAATAGGTGGGGGTTTAAGAAATTTACTAAGAAAAAATAAGTCTGCAACAAATTGGCATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 36.90% 0.44% 0.00% NA
All Indica  2759 67.50% 32.00% 0.54% 0.00% NA
All Japonica  1512 61.30% 38.60% 0.07% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 58.50% 40.70% 0.84% 0.00% NA
Indica II  465 94.20% 5.60% 0.22% 0.00% NA
Indica III  913 55.10% 44.60% 0.33% 0.00% NA
Indica Intermediate  786 72.90% 26.30% 0.76% 0.00% NA
Temperate Japonica  767 28.30% 71.60% 0.13% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 8.30% 2.08% 0.00% NA
Intermediate  90 74.40% 22.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609117647 G -> A LOC_Os06g16020.1 upstream_gene_variant ; 2220.0bp to feature; MODIFIER silent_mutation Average:76.982; most accessible tissue: Minghui63 root, score: 92.505 N N N N
vg0609117647 G -> A LOC_Os06g16010.1 downstream_gene_variant ; 4762.0bp to feature; MODIFIER silent_mutation Average:76.982; most accessible tissue: Minghui63 root, score: 92.505 N N N N
vg0609117647 G -> A LOC_Os06g16030.1 intron_variant ; MODIFIER silent_mutation Average:76.982; most accessible tissue: Minghui63 root, score: 92.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609117647 NA 5.20E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0609117647 NA 4.36E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 5.00E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 1.01E-06 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 5.19E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 3.94E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 7.84E-10 3.96E-12 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 9.44E-08 2.42E-11 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 9.06E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 9.91E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 1.62E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 2.63E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 8.74E-06 7.93E-14 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 4.72E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 2.06E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 1.55E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 8.56E-08 2.15E-11 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 3.22E-10 2.33E-18 mr1570_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609117647 NA 6.49E-06 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251