Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609030568:

Variant ID: vg0609030568 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 9030568
Reference Allele: AAlternative Allele: C,ATCGCCAGGGCGATCGC
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATATTTTTACCTGTCCTCACATGCCACATAAACTAAGAATTGTATTTGCTACATGCTCCATAGTGCAGGTCACTTGGGGGGAGGCTAATGGGCGATCG[A/C,ATCGCCAGGGCGATCGC]
TCAGCGATCGGTTTGCCCCGTCTCCCCCTATACTCCTCCCTCTTCTCCCCCTTCCTCCTCCCCTTCTCTTTCTACTACAGTACACCACACAATTTTTTTA

Reverse complement sequence

TAAAAAAATTGTGTGGTGTACTGTAGTAGAAAGAGAAGGGGAGGAGGAAGGGGGAGAAGAGGGAGGAGTATAGGGGGAGACGGGGCAAACCGATCGCTGA[T/G,GCGATCGCCCTGGCGAT]
CGATCGCCCATTAGCCTCCCCCCAAGTGACCTGCACTATGGAGCATGTAGCAAATACAATTCTTAGTTTATGTGGCATGTGAGGACAGGTAAAAATATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.50% 0.53% 0.00% ATCGCCAGGGCGATCGC: 0.04%
All Indica  2759 99.60% 0.20% 0.11% 0.00% ATCGCCAGGGCGATCGC: 0.07%
All Japonica  1512 97.60% 1.00% 1.39% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.10% 0.11% 0.00% ATCGCCAGGGCGATCGC: 0.11%
Indica Intermediate  786 99.50% 0.10% 0.25% 0.00% ATCGCCAGGGCGATCGC: 0.13%
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 95.40% 2.00% 2.58% 0.00% NA
Japonica Intermediate  241 96.70% 0.80% 2.49% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609030568 A -> C LOC_Os06g15910.1 downstream_gene_variant ; 3294.0bp to feature; MODIFIER silent_mutation Average:80.214; most accessible tissue: Callus, score: 94.483 N N N N
vg0609030568 A -> C LOC_Os06g15900-LOC_Os06g15910 intergenic_region ; MODIFIER silent_mutation Average:80.214; most accessible tissue: Callus, score: 94.483 N N N N
vg0609030568 A -> ATCGCCAGGGCGATCGC LOC_Os06g15910.1 downstream_gene_variant ; 3293.0bp to feature; MODIFIER silent_mutation Average:80.214; most accessible tissue: Callus, score: 94.483 N N N N
vg0609030568 A -> ATCGCCAGGGCGATCGC LOC_Os06g15900-LOC_Os06g15910 intergenic_region ; MODIFIER silent_mutation Average:80.214; most accessible tissue: Callus, score: 94.483 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0609030568 A ATCGC* -0.23 -0.17 -0.11 -0.02 -0.01 -0.01
vg0609030568 A C -0.05 -0.01 -0.02 -0.01 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609030568 NA 1.36E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609030568 NA 6.82E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609030568 NA 5.45E-06 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609030568 1.07E-06 NA mr1150_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609030568 NA 4.83E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251