\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609020767:

Variant ID: vg0609020767 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9020767
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TTATTTGGGGTTATATGCTGCGAATGAGAGGTGGGCCGCTGATGGTGATAGCTCAGTACGGGTATTCCTCAGCGCGTGTATATAGTCCTAAGTTAATTTC[C/T]
TGGGGAGGGTACTCCTTCGTATTTAGCCCTGGTTGTATGGTCATGACGGGCTGTCGTAAGGAGCTCGGCAGTCATGGGTGGCTTCTCGAAGTACCAGGAG

Reverse complement sequence

CTCCTGGTACTTCGAGAAGCCACCCATGACTGCCGAGCTCCTTACGACAGCCCGTCATGACCATACAACCAGGGCTAAATACGAAGGAGTACCCTCCCCA[G/A]
GAAATTAACTTAGGACTATATACACGCGCTGAGGAATACCCGTACTGAGCTATCACCATCAGCGGCCCACCTCTCATTCGCAGCATATAACCCCAAATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 27.90% 0.21% 0.06% NA
All Indica  2759 90.80% 8.90% 0.25% 0.11% NA
All Japonica  1512 48.90% 51.00% 0.13% 0.00% NA
Aus  269 3.00% 97.00% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 82.20% 17.00% 0.86% 0.00% NA
Indica III  913 94.70% 5.00% 0.11% 0.11% NA
Indica Intermediate  786 87.20% 12.30% 0.25% 0.25% NA
Temperate Japonica  767 75.90% 24.10% 0.00% 0.00% NA
Tropical Japonica  504 15.10% 84.70% 0.20% 0.00% NA
Japonica Intermediate  241 33.60% 66.00% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609020767 C -> T LOC_Os06g15890.1 upstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0609020767 C -> T LOC_Os06g15900.1 upstream_gene_variant ; 647.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0609020767 C -> T LOC_Os06g15880.1 downstream_gene_variant ; 2131.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0609020767 C -> T LOC_Os06g15890-LOC_Os06g15900 intergenic_region ; MODIFIER silent_mutation Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0609020767 C -> DEL N N silent_mutation Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609020767 NA 2.79E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 9.99E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 1.43E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 6.84E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 1.34E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 7.92E-07 NA mr1842 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 3.10E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 2.32E-06 1.40E-12 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 3.14E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 6.04E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 1.23E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 8.52E-10 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609020767 NA 3.28E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251