\
| Variant ID: vg0609020767 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9020767 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )
TTATTTGGGGTTATATGCTGCGAATGAGAGGTGGGCCGCTGATGGTGATAGCTCAGTACGGGTATTCCTCAGCGCGTGTATATAGTCCTAAGTTAATTTC[C/T]
TGGGGAGGGTACTCCTTCGTATTTAGCCCTGGTTGTATGGTCATGACGGGCTGTCGTAAGGAGCTCGGCAGTCATGGGTGGCTTCTCGAAGTACCAGGAG
CTCCTGGTACTTCGAGAAGCCACCCATGACTGCCGAGCTCCTTACGACAGCCCGTCATGACCATACAACCAGGGCTAAATACGAAGGAGTACCCTCCCCA[G/A]
GAAATTAACTTAGGACTATATACACGCGCTGAGGAATACCCGTACTGAGCTATCACCATCAGCGGCCCACCTCTCATTCGCAGCATATAACCCCAAATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 27.90% | 0.21% | 0.06% | NA |
| All Indica | 2759 | 90.80% | 8.90% | 0.25% | 0.11% | NA |
| All Japonica | 1512 | 48.90% | 51.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.20% | 17.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 94.70% | 5.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 87.20% | 12.30% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 15.10% | 84.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.60% | 66.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609020767 | C -> T | LOC_Os06g15890.1 | upstream_gene_variant ; 979.0bp to feature; MODIFIER | silent_mutation | Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0609020767 | C -> T | LOC_Os06g15900.1 | upstream_gene_variant ; 647.0bp to feature; MODIFIER | silent_mutation | Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0609020767 | C -> T | LOC_Os06g15880.1 | downstream_gene_variant ; 2131.0bp to feature; MODIFIER | silent_mutation | Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0609020767 | C -> T | LOC_Os06g15890-LOC_Os06g15900 | intergenic_region ; MODIFIER | silent_mutation | Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0609020767 | C -> DEL | N | N | silent_mutation | Average:47.999; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609020767 | NA | 2.79E-07 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 9.99E-10 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 1.43E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 6.84E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 1.34E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | 7.92E-07 | NA | mr1842 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 3.10E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | 2.32E-06 | 1.40E-12 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 3.14E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 6.04E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 1.23E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 8.52E-10 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609020767 | NA | 3.28E-09 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |