\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608948576:

Variant ID: vg0608948576 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8948576
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAATCATTTGGTACTGAATATTTAGAGGATGATTTGTAGGTTGGGATTGTTCTTGGTAGGGTTGTTTCACTTTGATGTAATTAGCTGAGTTCAATAAA[T/G]
CTTTCATTATAGAAGAGAGAGAGCGCGCATATGATTCTTATGATAACTTCACAGTACTTTGAATATTACATTCATTCTTCTTTTTTTCGACAATGAAAAT

Reverse complement sequence

ATTTTCATTGTCGAAAAAAAGAAGAATGAATGTAATATTCAAAGTACTGTGAAGTTATCATAAGAATCATATGCGCGCTCTCTCTCTTCTATAATGAAAG[A/C]
TTTATTGAACTCAGCTAATTACATCAAAGTGAAACAACCCTACCAAGAACAATCCCAACCTACAAATCATCCTCTAAATATTCAGTACCAAATGATTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 34.80% 0.04% 0.30% NA
All Indica  2759 88.00% 11.60% 0.00% 0.43% NA
All Japonica  1512 39.00% 60.80% 0.00% 0.13% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 81.90% 17.00% 0.00% 1.08% NA
Indica III  913 86.60% 13.10% 0.00% 0.22% NA
Indica Intermediate  786 86.90% 12.50% 0.00% 0.64% NA
Temperate Japonica  767 72.40% 27.60% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.00% 0.20% NA
Japonica Intermediate  241 10.40% 89.20% 0.00% 0.41% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608948576 T -> G LOC_Os06g15750-LOC_Os06g15760 intergenic_region ; MODIFIER silent_mutation Average:53.298; most accessible tissue: Minghui63 root, score: 81.681 N N N N
vg0608948576 T -> DEL N N silent_mutation Average:53.298; most accessible tissue: Minghui63 root, score: 81.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608948576 NA 6.79E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 8.17E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 4.50E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 6.65E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 2.15E-11 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 2.02E-09 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 4.28E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 4.97E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 3.99E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 2.20E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 9.38E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 6.35E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 7.86E-06 mr1425_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 1.08E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 2.98E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 8.14E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 1.04E-06 1.03E-13 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 4.24E-10 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608948576 NA 7.44E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251