\
| Variant ID: vg0608916603 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8916603 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGCAAGTTGATTAGCTTTATGACATCCGGACTAATTGCTTTTAGACTTGAACCATTTGCATCAACAACCTATAGGCTGTAAAGGCACCAGAATTTCTC[C/T]
GGCAATTCTTGTACACCGCTATAAGAAATATCAAGATAACGGAGACTGTTCAACTCGCCTATGCTCTCAGGTAGCTTGACCACCGTGCAACCCTTTAGGC
GCCTAAAGGGTTGCACGGTGGTCAAGCTACCTGAGAGCATAGGCGAGTTGAACAGTCTCCGTTATCTTGATATTTCTTATAGCGGTGTACAAGAATTGCC[G/A]
GAGAAATTCTGGTGCCTTTACAGCCTATAGGTTGTTGATGCAAATGGTTCAAGTCTAAAAGCAATTAGTCCGGATGTCATAAAGCTAATCAACTTGCATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 96.70% | 3.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 82.70% | 17.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.30% | 9.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 33.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608916603 | C -> T | LOC_Os06g15730.1 | 5_prime_UTR_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:33.276; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608916603 | 7.63E-07 | NA | mr1020 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | NA | 6.95E-07 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 4.11E-07 | NA | mr1032 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 1.45E-08 | 1.45E-08 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 2.08E-06 | NA | mr1165 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 1.23E-07 | 1.23E-07 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 8.53E-06 | NA | mr1477 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 1.10E-06 | NA | mr1478 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 2.36E-08 | 2.36E-08 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 8.05E-09 | NA | mr1971 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | 1.94E-06 | 3.95E-08 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | NA | 1.50E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608916603 | NA | 8.73E-16 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |