\
| Variant ID: vg0608915375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8915375 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )
ATTATCAACAGAAGGCTCTGGGTGCCGCAGCGTGAAGAAAAATACCCCGGAAGTCTTTAGAAATCAGCTATGCTTTATCCATATAAGTGATAGGTAAATT[G/T]
AAGCAGTTCCTTCTTGTCCTTATTAGTCAGCAGGCACTTTTTAAAGGGCTGCTCTACTTCGTGCAGCTTTGGGCAGATCGATATGCTCACGAACTGCATG
CATGCAGTTCGTGAGCATATCGATCTGCCCAAAGCTGCACGAAGTAGAGCAGCCCTTTAAAAAGTGCCTGCTGACTAATAAGGACAAGAAGGAACTGCTT[C/A]
AATTTACCTATCACTTATATGGATAAAGCATAGCTGATTTCTAAAGACTTCCGGGGTATTTTTCTTCACGCTGCGGCACCCAGAGCCTTCTGTTGATAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.80% | 33.90% | 0.08% | 0.25% | NA |
| All Indica | 2759 | 43.00% | 56.50% | 0.11% | 0.36% | NA |
| All Japonica | 1512 | 99.00% | 0.80% | 0.07% | 0.13% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 44.90% | 55.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 23.40% | 75.50% | 0.00% | 1.08% | NA |
| Indica III | 913 | 57.20% | 42.70% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 36.80% | 62.50% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608915375 | G -> T | LOC_Os06g15730.1 | 3_prime_UTR_variant ; 169.0bp to feature; MODIFIER | silent_mutation | Average:54.847; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| vg0608915375 | G -> DEL | N | N | silent_mutation | Average:54.847; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608915375 | NA | 5.72E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 6.39E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 7.48E-09 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 8.67E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 1.10E-18 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 4.71E-08 | mr1578_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 2.28E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 2.11E-06 | mr1668_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 3.90E-08 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 1.38E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608915375 | NA | 5.94E-07 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |