Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608911819:

Variant ID: vg0608911819 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8911819
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCGTGGATTAGCGCTAGGGAAAATTTCATCTATACCACAAACTTTTGAGCGGTACCCAAAAAATAGCATAGAACTTCCCACCTTCCCAACAATACCACA[G/T,A]
TAGAACAGGAGCGGAACGGGGCGGCACGGGAAATAGCGCGATAGACAGGATTACCCCTCAGGCTTATCCCTTTCATTCATGCACTCGTCTCTCCCTCTCC

Reverse complement sequence

GGAGAGGGAGAGACGAGTGCATGAATGAAAGGGATAAGCCTGAGGGGTAATCCTGTCTATCGCGCTATTTCCCGTGCCGCCCCGTTCCGCTCCTGTTCTA[C/A,T]
TGTGGTATTGTTGGGAAGGTGGGAAGTTCTATGCTATTTTTTGGGTACCGCTCAAAAGTTTGTGGTATAGATGAAATTTTCCCTAGCGCTAATCCACGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.80%	9.50%	0.15%	17.52%	A: 0.04%
All Indica	2759	66.70%	3.20%	0.22%	29.79%	A: 0.07%
All Japonica	1512	82.70%	17.30%	0.00%	0.07%	NA
Aus	269	98.10%	1.50%	0.00%	0.37%	NA
Indica I	595	60.70%	0.00%	0.34%	38.82%	A: 0.17%
Indica II	465	94.60%	0.00%	0.00%	5.38%	NA
Indica III	913	46.70%	9.60%	0.22%	43.37%	A: 0.11%
Indica Intermediate	786	78.00%	0.10%	0.25%	21.63%	NA
Temperate Japonica	767	89.20%	10.80%	0.00%	0.00%	NA
Tropical Japonica	504	80.40%	19.60%	0.00%	0.00%	NA
Japonica Intermediate	241	66.80%	32.80%	0.00%	0.41%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	84.40%	10.00%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608911819	G -> T	LOC_Os06g15720.1	upstream_gene_variant ; 2141.0bp to feature; MODIFIER	silent_mutation	Average:31.038; most accessible tissue: Callus, score: 70.315	N	N	N	N
vg0608911819	G -> T	LOC_Os06g15730.1	downstream_gene_variant ; 2112.0bp to feature; MODIFIER	silent_mutation	Average:31.038; most accessible tissue: Callus, score: 70.315	N	N	N	N
vg0608911819	G -> T	LOC_Os06g15720-LOC_Os06g15730	intergenic_region ; MODIFIER	silent_mutation	Average:31.038; most accessible tissue: Callus, score: 70.315	N	N	N	N
vg0608911819	G -> A	LOC_Os06g15720.1	upstream_gene_variant ; 2141.0bp to feature; MODIFIER	silent_mutation	Average:31.038; most accessible tissue: Callus, score: 70.315	N	N	N	N
vg0608911819	G -> A	LOC_Os06g15730.1	downstream_gene_variant ; 2112.0bp to feature; MODIFIER	silent_mutation	Average:31.038; most accessible tissue: Callus, score: 70.315	N	N	N	N
vg0608911819	G -> A	LOC_Os06g15720-LOC_Os06g15730	intergenic_region ; MODIFIER	silent_mutation	Average:31.038; most accessible tissue: Callus, score: 70.315	N	N	N	N
vg0608911819	G -> DEL	N	N	silent_mutation	Average:31.038; most accessible tissue: Callus, score: 70.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608911819	1.98E-06	NA	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	6.83E-06	1.07E-07	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	9.89E-07	NA	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	1.28E-09	1.28E-09	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	4.15E-06	NA	mr1165	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	2.00E-08	2.00E-08	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	7.40E-06	NA	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	8.20E-06	8.20E-06	mr1477	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	2.22E-06	NA	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	2.61E-09	2.61E-09	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	NA	5.36E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	1.56E-07	NA	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	3.27E-07	3.01E-09	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	NA	9.88E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	NA	1.12E-12	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608911819	NA	1.15E-18	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251