\
| Variant ID: vg0608911819 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8911819 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGCGTGGATTAGCGCTAGGGAAAATTTCATCTATACCACAAACTTTTGAGCGGTACCCAAAAAATAGCATAGAACTTCCCACCTTCCCAACAATACCACA[G/T,A]
TAGAACAGGAGCGGAACGGGGCGGCACGGGAAATAGCGCGATAGACAGGATTACCCCTCAGGCTTATCCCTTTCATTCATGCACTCGTCTCTCCCTCTCC
GGAGAGGGAGAGACGAGTGCATGAATGAAAGGGATAAGCCTGAGGGGTAATCCTGTCTATCGCGCTATTTCCCGTGCCGCCCCGTTCCGCTCCTGTTCTA[C/A,T]
TGTGGTATTGTTGGGAAGGTGGGAAGTTCTATGCTATTTTTTGGGTACCGCTCAAAAGTTTGTGGTATAGATGAAATTTTCCCTAGCGCTAATCCACGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.80% | 9.50% | 0.15% | 17.52% | A: 0.04% |
| All Indica | 2759 | 66.70% | 3.20% | 0.22% | 29.79% | A: 0.07% |
| All Japonica | 1512 | 82.70% | 17.30% | 0.00% | 0.07% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 60.70% | 0.00% | 0.34% | 38.82% | A: 0.17% |
| Indica II | 465 | 94.60% | 0.00% | 0.00% | 5.38% | NA |
| Indica III | 913 | 46.70% | 9.60% | 0.22% | 43.37% | A: 0.11% |
| Indica Intermediate | 786 | 78.00% | 0.10% | 0.25% | 21.63% | NA |
| Temperate Japonica | 767 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.80% | 32.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 10.00% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608911819 | G -> T | LOC_Os06g15720.1 | upstream_gene_variant ; 2141.0bp to feature; MODIFIER | silent_mutation | Average:31.038; most accessible tissue: Callus, score: 70.315 | N | N | N | N |
| vg0608911819 | G -> T | LOC_Os06g15730.1 | downstream_gene_variant ; 2112.0bp to feature; MODIFIER | silent_mutation | Average:31.038; most accessible tissue: Callus, score: 70.315 | N | N | N | N |
| vg0608911819 | G -> T | LOC_Os06g15720-LOC_Os06g15730 | intergenic_region ; MODIFIER | silent_mutation | Average:31.038; most accessible tissue: Callus, score: 70.315 | N | N | N | N |
| vg0608911819 | G -> A | LOC_Os06g15720.1 | upstream_gene_variant ; 2141.0bp to feature; MODIFIER | silent_mutation | Average:31.038; most accessible tissue: Callus, score: 70.315 | N | N | N | N |
| vg0608911819 | G -> A | LOC_Os06g15730.1 | downstream_gene_variant ; 2112.0bp to feature; MODIFIER | silent_mutation | Average:31.038; most accessible tissue: Callus, score: 70.315 | N | N | N | N |
| vg0608911819 | G -> A | LOC_Os06g15720-LOC_Os06g15730 | intergenic_region ; MODIFIER | silent_mutation | Average:31.038; most accessible tissue: Callus, score: 70.315 | N | N | N | N |
| vg0608911819 | G -> DEL | N | N | silent_mutation | Average:31.038; most accessible tissue: Callus, score: 70.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608911819 | 1.98E-06 | NA | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 6.83E-06 | 1.07E-07 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 9.89E-07 | NA | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 1.28E-09 | 1.28E-09 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 4.15E-06 | NA | mr1165 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 2.00E-08 | 2.00E-08 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 7.40E-06 | NA | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 8.20E-06 | 8.20E-06 | mr1477 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 2.22E-06 | NA | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 2.61E-09 | 2.61E-09 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | NA | 5.36E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 1.56E-07 | NA | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | 3.27E-07 | 3.01E-09 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | NA | 9.88E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | NA | 1.12E-12 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608911819 | NA | 1.15E-18 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |