\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608909772:

Variant ID: vg0608909772 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8909772
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GACCCATTGCTGTTCGTTGAGGTGGTAGGATAGGTATATAGACTAGGCATCCAAATTTGAACAGATGGGACAATTTCGGTGTGACCCCTTGCACCAGTTT[C/T]
ATTTTTGAATGGATGTTGTAGGCCGATGATCTGAAATTAATAAGATTTACCACGTGTAGGGCTGCATGTCCCCAACACGTGCTTGGCAATTTACAACCTT

Reverse complement sequence

AAGGTTGTAAATTGCCAAGCACGTGTTGGGGACATGCAGCCCTACACGTGGTAAATCTTATTAATTTCAGATCATCGGCCTACAACATCCATTCAAAAAT[G/A]
AAACTGGTGCAAGGGGTCACACCGAAATTGTCCCATCTGTTCAAATTTGGATGCCTAGTCTATATACCTATCCTACCACCTCAACGAACAGCAATGGGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.30% 15.10% 0.57% 50.04% NA
All Indica  2759 11.10% 3.80% 0.94% 84.16% NA
All Japonica  1512 81.90% 17.30% 0.00% 0.73% NA
Aus  269 10.80% 88.50% 0.00% 0.74% NA
Indica I  595 6.60% 0.00% 0.84% 92.61% NA
Indica II  465 21.90% 0.00% 0.65% 77.42% NA
Indica III  913 5.10% 9.70% 0.55% 84.56% NA
Indica Intermediate  786 15.10% 1.90% 1.65% 81.30% NA
Temperate Japonica  767 88.50% 10.80% 0.00% 0.65% NA
Tropical Japonica  504 80.00% 19.40% 0.00% 0.60% NA
Japonica Intermediate  241 65.10% 33.60% 0.00% 1.24% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 50.00% 15.60% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608909772 C -> T LOC_Os06g15710.1 upstream_gene_variant ; 4892.0bp to feature; MODIFIER silent_mutation Average:51.614; most accessible tissue: Callus, score: 96.107 N N N N
vg0608909772 C -> T LOC_Os06g15720.1 upstream_gene_variant ; 94.0bp to feature; MODIFIER silent_mutation Average:51.614; most accessible tissue: Callus, score: 96.107 N N N N
vg0608909772 C -> T LOC_Os06g15730.1 downstream_gene_variant ; 4159.0bp to feature; MODIFIER silent_mutation Average:51.614; most accessible tissue: Callus, score: 96.107 N N N N
vg0608909772 C -> T LOC_Os06g15720-LOC_Os06g15730 intergenic_region ; MODIFIER silent_mutation Average:51.614; most accessible tissue: Callus, score: 96.107 N N N N
vg0608909772 C -> DEL N N silent_mutation Average:51.614; most accessible tissue: Callus, score: 96.107 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608909772 C T 0.01 0.0 -0.01 0.0 0.02 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608909772 6.83E-06 1.07E-07 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 1.28E-09 1.28E-09 mr1032 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.00E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.24E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 2.00E-08 2.00E-08 mr1165 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.23E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.02E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 8.20E-06 8.20E-06 mr1477 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 2.61E-09 2.61E-09 mr1478 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.07E-14 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.23E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 7.26E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 3.92E-09 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 4.62E-06 NA mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 3.27E-07 3.01E-09 mr1971 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 6.04E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.67E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 1.36E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 2.95E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608909772 NA 2.39E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251