\
| Variant ID: vg0608860294 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8860294 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCACAATGTCGAAGCCGAATTGCACAGCCGGCCGAAACACGTGCCAAAGCCCACCCCGCATGACAAAATAGTAAAAGTGCAGATTGACCATGCCGACCC[C/T]
GCAAAGCTCGTATCACTGGGGGACGGCATGGGTGAACAAGAAGCTGAGGGCATCCTAGCGGTGCTCAAAAAGAACATTGATATTTTCGCTTGGAGCCCCG
CGGGGCTCCAAGCGAAAATATCAATGTTCTTTTTGAGCACCGCTAGGATGCCCTCAGCTTCTTGTTCACCCATGCCGTCCCCCAGTGATACGAGCTTTGC[G/A]
GGGTCGGCATGGTCAATCTGCACTTTTACTATTTTGTCATGCGGGGTGGGCTTTGGCACGTGTTTCGGCCGGCTGTGCAATTCGGCTTCGACATTGTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 3.70% | 1.27% | 13.03% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.14% | 0.14% | NA |
| All Japonica | 1512 | 47.30% | 11.40% | 2.98% | 38.29% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.50% | 0.34% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 77.20% | 0.00% | 1.04% | 21.77% | NA |
| Tropical Japonica | 504 | 13.30% | 31.00% | 5.16% | 50.60% | NA |
| Japonica Intermediate | 241 | 23.20% | 7.10% | 4.56% | 65.15% | NA |
| VI/Aromatic | 96 | 61.50% | 0.00% | 10.42% | 28.12% | NA |
| Intermediate | 90 | 91.10% | 2.20% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608860294 | C -> T | LOC_Os06g15640.1 | synonymous_variant ; p.Pro480Pro; LOW | synonymous_codon | Average:16.252; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0608860294 | C -> DEL | LOC_Os06g15640.1 | N | frameshift_variant | Average:16.252; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608860294 | 1.01E-06 | 9.29E-08 | mr1215 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | 1.27E-07 | 9.04E-10 | mr1218 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | 3.57E-06 | 3.57E-06 | mr1256 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 4.69E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 6.24E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 2.52E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 3.34E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | 1.22E-06 | 2.09E-09 | mr1422 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | 7.25E-06 | 4.42E-10 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 3.04E-06 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 4.70E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 6.60E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 1.24E-07 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 2.98E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 1.12E-06 | mr1222_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 1.35E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608860294 | NA | 1.26E-06 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |