\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608836602:

Variant ID: vg0608836602 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8836602
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACATGACATCTCATCACACAAGCTAGTACTCTCTCTGTTTCACCGTTTCAGATTATAAGTCGTTTTGACTTTGATCAAAATCAAACTATTTTAAATTT[A/G]
ATTAAGTTTGTAGAAAAAAAACTGTAATATTTTTAACCCAAAATAAATATATTAAGAAAATATACTTAATTATTGATCTAATAAAACTAATTTGGTTTTA

Reverse complement sequence

TAAAACCAAATTAGTTTTATTAGATCAATAATTAAGTATATTTTCTTAATATATTTATTTTGGGTTAAAAATATTACAGTTTTTTTTCTACAAACTTAAT[T/C]
AAATTTAAAATAGTTTGATTTTGATCAAAGTCAAAACGACTTATAATCTGAAACGGTGAAACAGAGAGAGTACTAGCTTGTGTGATGAGATGTCATGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 6.70% 3.51% 0.00% NA
All Indica  2759 99.30% 0.40% 0.33% 0.00% NA
All Japonica  1512 85.50% 4.20% 10.25% 0.00% NA
Aus  269 14.10% 85.90% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.40% 0.38% 0.00% NA
Temperate Japonica  767 73.00% 6.90% 20.08% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608836602 A -> G LOC_Os06g15570.1 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0608836602 A -> G LOC_Os06g15590.1 upstream_gene_variant ; 973.0bp to feature; MODIFIER silent_mutation Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0608836602 A -> G LOC_Os06g15570.2 upstream_gene_variant ; 4291.0bp to feature; MODIFIER silent_mutation Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0608836602 A -> G LOC_Os06g15580.1 downstream_gene_variant ; 2216.0bp to feature; MODIFIER silent_mutation Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0608836602 A -> G LOC_Os06g15600.1 downstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0608836602 A -> G LOC_Os06g15590-LOC_Os06g15600 intergenic_region ; MODIFIER silent_mutation Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608836602 3.99E-11 NA Awn_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0608836602 2.95E-06 3.87E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0608836602 NA 1.27E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602 NA 2.45E-41 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602 NA 4.81E-39 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602 NA 2.88E-37 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602 NA 4.89E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602 NA 3.73E-31 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602 NA 1.30E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251