\
| Variant ID: vg0608836602 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8836602 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGACATGACATCTCATCACACAAGCTAGTACTCTCTCTGTTTCACCGTTTCAGATTATAAGTCGTTTTGACTTTGATCAAAATCAAACTATTTTAAATTT[A/G]
ATTAAGTTTGTAGAAAAAAAACTGTAATATTTTTAACCCAAAATAAATATATTAAGAAAATATACTTAATTATTGATCTAATAAAACTAATTTGGTTTTA
TAAAACCAAATTAGTTTTATTAGATCAATAATTAAGTATATTTTCTTAATATATTTATTTTGGGTTAAAAATATTACAGTTTTTTTTCTACAAACTTAAT[T/C]
AAATTTAAAATAGTTTGATTTTGATCAAAGTCAAAACGACTTATAATCTGAAACGGTGAAACAGAGAGAGTACTAGCTTGTGTGATGAGATGTCATGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 6.70% | 3.51% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.40% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 85.50% | 4.20% | 10.25% | 0.00% | NA |
| Aus | 269 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.40% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 73.00% | 6.90% | 20.08% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608836602 | A -> G | LOC_Os06g15570.1 | upstream_gene_variant ; 4647.0bp to feature; MODIFIER | silent_mutation | Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0608836602 | A -> G | LOC_Os06g15590.1 | upstream_gene_variant ; 973.0bp to feature; MODIFIER | silent_mutation | Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0608836602 | A -> G | LOC_Os06g15570.2 | upstream_gene_variant ; 4291.0bp to feature; MODIFIER | silent_mutation | Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0608836602 | A -> G | LOC_Os06g15580.1 | downstream_gene_variant ; 2216.0bp to feature; MODIFIER | silent_mutation | Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0608836602 | A -> G | LOC_Os06g15600.1 | downstream_gene_variant ; 355.0bp to feature; MODIFIER | silent_mutation | Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0608836602 | A -> G | LOC_Os06g15590-LOC_Os06g15600 | intergenic_region ; MODIFIER | silent_mutation | Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608836602 | 3.99E-11 | NA | Awn_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0608836602 | 2.95E-06 | 3.87E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0608836602 | NA | 1.27E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608836602 | NA | 2.45E-41 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608836602 | NA | 4.81E-39 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608836602 | NA | 2.88E-37 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608836602 | NA | 4.89E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608836602 | NA | 3.73E-31 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608836602 | NA | 1.30E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |