RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0608717175:

Variant ID: vg0608717175 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8717175
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGAACTTCAGAGTGGTATCCAACTTTTTGTGCCCCTGCTAGTAACCTGGGTACAACGACATTCTGTAGTCCTCTAACATCTTGTCCAATTTATGGGCC[C/T]
CCTTTTCACTTTCGCAGTCCTCCTTGGCGTCCTGCAACATCTGACCAAGATCATCAGCAACGTCGTTACCATCAGCATCCCTTTCCTCCTCACCCGTTTG

Reverse complement sequence

CAAACGGGTGAGGAGGAAAGGGATGCTGATGGTAACGACGTTGCTGATGATCTTGGTCAGATGTTGCAGGACGCCAAGGAGGACTGCGAAAGTGAAAAGG[G/A]
GGCCCATAAATTGGACAAGATGTTAGAGGACTACAGAATGTCGTTGTACCCAGGTTACTAGCAGGGGCACAAAAAGTTGGATACCACTCTGAAGTTCTTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	4.10%	7.96%	28.16%	NA
All Indica	2759	32.90%	6.80%	13.16%	47.08%	NA
All Japonica	1512	99.10%	0.10%	0.26%	0.53%	NA
Aus	269	98.50%	0.40%	0.74%	0.37%	NA
Indica I	595	34.60%	6.70%	12.27%	46.39%	NA
Indica II	465	18.50%	5.60%	13.76%	62.15%	NA
Indica III	913	45.60%	7.70%	12.49%	34.28%	NA
Indica Intermediate	786	25.60%	6.60%	14.25%	53.56%	NA
Temperate Japonica	767	99.10%	0.00%	0.13%	0.78%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	98.30%	0.80%	0.41%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	63.30%	3.30%	7.78%	25.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608717175	C -> T	LOC_Os06g15350.1	missense_variant ; p.Gly57Glu; MODERATE	nonsynonymous_codon ; G57E	Average:15.888; most accessible tissue: Callus, score: 31.397	benign	0.908	TOLERATED	1.00
vg0608717175	C -> DEL	LOC_Os06g15350.1	N	frameshift_variant	Average:15.888; most accessible tissue: Callus, score: 31.397	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608717175	NA	1.25E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	8.06E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	8.90E-37	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	3.09E-08	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	1.45E-08	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	1.07E-07	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	7.40E-06	mr1248_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	9.56E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	5.95E-21	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608717175	NA	3.74E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 22 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0608717175:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact