Variant ID: vg0608717175 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 8717175 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )
CAAGAACTTCAGAGTGGTATCCAACTTTTTGTGCCCCTGCTAGTAACCTGGGTACAACGACATTCTGTAGTCCTCTAACATCTTGTCCAATTTATGGGCC[C/T]
CCTTTTCACTTTCGCAGTCCTCCTTGGCGTCCTGCAACATCTGACCAAGATCATCAGCAACGTCGTTACCATCAGCATCCCTTTCCTCCTCACCCGTTTG
CAAACGGGTGAGGAGGAAAGGGATGCTGATGGTAACGACGTTGCTGATGATCTTGGTCAGATGTTGCAGGACGCCAAGGAGGACTGCGAAAGTGAAAAGG[G/A]
GGCCCATAAATTGGACAAGATGTTAGAGGACTACAGAATGTCGTTGTACCCAGGTTACTAGCAGGGGCACAAAAAGTTGGATACCACTCTGAAGTTCTTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 59.80% | 4.10% | 7.96% | 28.16% | NA |
All Indica | 2759 | 32.90% | 6.80% | 13.16% | 47.08% | NA |
All Japonica | 1512 | 99.10% | 0.10% | 0.26% | 0.53% | NA |
Aus | 269 | 98.50% | 0.40% | 0.74% | 0.37% | NA |
Indica I | 595 | 34.60% | 6.70% | 12.27% | 46.39% | NA |
Indica II | 465 | 18.50% | 5.60% | 13.76% | 62.15% | NA |
Indica III | 913 | 45.60% | 7.70% | 12.49% | 34.28% | NA |
Indica Intermediate | 786 | 25.60% | 6.60% | 14.25% | 53.56% | NA |
Temperate Japonica | 767 | 99.10% | 0.00% | 0.13% | 0.78% | NA |
Tropical Japonica | 504 | 99.40% | 0.00% | 0.40% | 0.20% | NA |
Japonica Intermediate | 241 | 98.30% | 0.80% | 0.41% | 0.41% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 63.30% | 3.30% | 7.78% | 25.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0608717175 | C -> T | LOC_Os06g15350.1 | missense_variant ; p.Gly57Glu; MODERATE | nonsynonymous_codon ; G57E | Average:15.888; most accessible tissue: Callus, score: 31.397 | benign ![]() |
0.908 ![]() |
TOLERATED | 1.00 |
vg0608717175 | C -> DEL | LOC_Os06g15350.1 | N | frameshift_variant | Average:15.888; most accessible tissue: Callus, score: 31.397 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0608717175 | NA | 1.25E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 8.06E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 8.90E-37 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 3.09E-08 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 1.45E-08 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 1.07E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 7.40E-06 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 9.56E-07 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 5.95E-21 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608717175 | NA | 3.74E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/