\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608694617:

Variant ID: vg0608694617 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8694617
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCCAATGTCATACACCAAATTATACTGTCAGAATCGGCTGCATCGGCTCACCTAGTCCGACTCAGACCCAGCCGATCCTAATCGTAGCCGATCTGGA[C/T]
TTCAGCCGATTCTTGCTCTGTTCTCGGATCAATCTCCGCCTTCGACTCCACCTTGACCTAATCTCCTTTTCCGATGCTAATATTTCCAAATTTGGTCGTT

Reverse complement sequence

AACGACCAAATTTGGAAATATTAGCATCGGAAAAGGAGATTAGGTCAAGGTGGAGTCGAAGGCGGAGATTGATCCGAGAACAGAGCAAGAATCGGCTGAA[G/A]
TCCAGATCGGCTACGATTAGGATCGGCTGGGTCTGAGTCGGACTAGGTGAGCCGATGCAGCCGATTCTGACAGTATAATTTGGTGTATGACATTGGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 21.40% 0.53% 34.96% NA
All Indica  2759 5.80% 35.00% 0.87% 58.35% NA
All Japonica  1512 99.00% 0.10% 0.00% 0.86% NA
Aus  269 85.50% 13.80% 0.37% 0.37% NA
Indica I  595 4.50% 40.30% 0.34% 54.79% NA
Indica II  465 5.80% 16.10% 1.08% 76.99% NA
Indica III  913 4.20% 50.20% 0.88% 44.80% NA
Indica Intermediate  786 8.70% 24.40% 1.15% 65.78% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 99.20% 0.20% 0.00% 0.60% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 61.10% 7.80% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608694617 C -> T LOC_Os06g15310.1 upstream_gene_variant ; 4572.0bp to feature; MODIFIER silent_mutation Average:31.469; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0608694617 C -> T LOC_Os06g15320.1 downstream_gene_variant ; 1096.0bp to feature; MODIFIER silent_mutation Average:31.469; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0608694617 C -> T LOC_Os06g15310-LOC_Os06g15320 intergenic_region ; MODIFIER silent_mutation Average:31.469; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0608694617 C -> DEL N N silent_mutation Average:31.469; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608694617 NA 4.60E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608694617 NA 2.73E-06 mr1446 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608694617 NA 1.96E-07 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608694617 NA 1.16E-06 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251