\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608680831:

Variant ID: vg0608680831 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8680831
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATCGTATTTAAATTTAATTGATCCAAATATGGTCGCGATAATATTTTATTTATTTCTATCCCCACCTAATCTTTATTTTAATTTGTATGTATTTTAC[C/A]
AATTTTGTTTTTACGGTTTATTCCTATTTAACTATTCTTTACTCACGATTAATAATCTTCGAGATCAAATCCAGATAAAATAGACGAATAAGATCGGCAT

Reverse complement sequence

ATGCCGATCTTATTCGTCTATTTTATCTGGATTTGATCTCGAAGATTATTAATCGTGAGTAAAGAATAGTTAAATAGGAATAAACCGTAAAAACAAAATT[G/T]
GTAAAATACATACAAATTAAAATAAAGATTAGGTGGGGATAGAAATAAATAAAATATTATCGCGACCATATTTGGATCAATTAAATTTAAATACGATGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 9.30% 2.39% 55.88% NA
All Indica  2759 3.20% 1.30% 2.79% 92.68% NA
All Japonica  1512 73.50% 24.50% 0.99% 1.06% NA
Aus  269 76.20% 6.30% 5.58% 11.90% NA
Indica I  595 1.70% 0.00% 3.03% 95.29% NA
Indica II  465 1.70% 2.60% 0.86% 94.84% NA
Indica III  913 3.20% 1.20% 4.38% 91.24% NA
Indica Intermediate  786 5.20% 1.80% 1.91% 91.09% NA
Temperate Japonica  767 92.40% 5.60% 0.91% 1.04% NA
Tropical Japonica  504 40.50% 57.30% 1.39% 0.79% NA
Japonica Intermediate  241 82.20% 15.80% 0.41% 1.66% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 38.90% 17.80% 4.44% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608680831 C -> A LOC_Os06g15310.1 downstream_gene_variant ; 2311.0bp to feature; MODIFIER silent_mutation Average:6.353; most accessible tissue: Callus, score: 10.822 N N N N
vg0608680831 C -> A LOC_Os06g15280-LOC_Os06g15310 intergenic_region ; MODIFIER silent_mutation Average:6.353; most accessible tissue: Callus, score: 10.822 N N N N
vg0608680831 C -> DEL N N silent_mutation Average:6.353; most accessible tissue: Callus, score: 10.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608680831 NA 3.10E-23 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 8.02E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 2.51E-06 4.76E-21 mr1518 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 1.22E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 7.83E-06 1.61E-22 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 4.35E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 7.25E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 7.13E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 1.60E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 7.62E-24 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 2.70E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 2.60E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 2.33E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 4.32E-06 1.14E-22 mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 1.12E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 5.73E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 7.42E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 6.19E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608680831 NA 1.74E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251