\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608669135:

Variant ID: vg0608669135 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8669135
Reference Allele: TAlternative Allele: A,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAAACCGTAGCCAGGCTAAGCTGGAGTTATATTAAGGAGAATAGAAAGTATTTACAATATCACCAAGGGAGGTGAAAGAGAGAAAAATAAAGAAACA[T/A,G]
GAAGAAAAATAGAAAAGAAACACACACTAAATGAAATGAAAATCTAAGCGGATATTCTCGCAATATTTTTTGCCCCACACATGCTCCATAGCTTGATTTC

Reverse complement sequence

GAAATCAAGCTATGGAGCATGTGTGGGGCAAAAAATATTGCGAGAATATCCGCTTAGATTTTCATTTCATTTAGTGTGTGTTTCTTTTCTATTTTTCTTC[A/T,C]
TGTTTCTTTATTTTTCTCTCTTTCACCTCCCTTGGTGATATTGTAAATACTTTCTATTCTCCTTAATATAACTCCAGCTTAGCCTGGCTACGGTTTCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 8.20% 3.70% 13.22% G: 0.04%
All Indica  2759 59.60% 13.70% 5.91% 20.80% NA
All Japonica  1512 96.90% 0.10% 0.60% 2.45% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 63.50% 10.80% 5.88% 19.83% NA
Indica II  465 44.30% 20.40% 6.24% 29.03% NA
Indica III  913 67.40% 9.20% 5.04% 18.40% NA
Indica Intermediate  786 56.60% 17.20% 6.74% 19.47% NA
Temperate Japonica  767 97.50% 0.00% 0.65% 1.83% NA
Tropical Japonica  504 96.40% 0.00% 0.79% 2.78% NA
Japonica Intermediate  241 95.90% 0.40% 0.00% 3.73% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 71.10% 8.90% 3.33% 14.44% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608669135 T -> G LOC_Os06g15260.1 upstream_gene_variant ; 2807.0bp to feature; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> G LOC_Os06g15280.1 upstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> G LOC_Os06g15270.1 downstream_gene_variant ; 425.0bp to feature; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> G LOC_Os06g15260-LOC_Os06g15270 intergenic_region ; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> A LOC_Os06g15260.1 upstream_gene_variant ; 2807.0bp to feature; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> A LOC_Os06g15280.1 upstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> A LOC_Os06g15270.1 downstream_gene_variant ; 425.0bp to feature; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> A LOC_Os06g15260-LOC_Os06g15270 intergenic_region ; MODIFIER silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0608669135 T -> DEL N N silent_mutation Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608669135 2.88E-07 1.34E-06 mr1125 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608669135 8.44E-06 NA mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608669135 NA 8.49E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608669135 2.90E-06 9.15E-07 mr1971 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251