\
| Variant ID: vg0608669135 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8669135 |
| Reference Allele: T | Alternative Allele: A,G |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 268. )
TTTGAAACCGTAGCCAGGCTAAGCTGGAGTTATATTAAGGAGAATAGAAAGTATTTACAATATCACCAAGGGAGGTGAAAGAGAGAAAAATAAAGAAACA[T/A,G]
GAAGAAAAATAGAAAAGAAACACACACTAAATGAAATGAAAATCTAAGCGGATATTCTCGCAATATTTTTTGCCCCACACATGCTCCATAGCTTGATTTC
GAAATCAAGCTATGGAGCATGTGTGGGGCAAAAAATATTGCGAGAATATCCGCTTAGATTTTCATTTCATTTAGTGTGTGTTTCTTTTCTATTTTTCTTC[A/T,C]
TGTTTCTTTATTTTTCTCTCTTTCACCTCCCTTGGTGATATTGTAAATACTTTCTATTCTCCTTAATATAACTCCAGCTTAGCCTGGCTACGGTTTCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 8.20% | 3.70% | 13.22% | G: 0.04% |
| All Indica | 2759 | 59.60% | 13.70% | 5.91% | 20.80% | NA |
| All Japonica | 1512 | 96.90% | 0.10% | 0.60% | 2.45% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 63.50% | 10.80% | 5.88% | 19.83% | NA |
| Indica II | 465 | 44.30% | 20.40% | 6.24% | 29.03% | NA |
| Indica III | 913 | 67.40% | 9.20% | 5.04% | 18.40% | NA |
| Indica Intermediate | 786 | 56.60% | 17.20% | 6.74% | 19.47% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 0.65% | 1.83% | NA |
| Tropical Japonica | 504 | 96.40% | 0.00% | 0.79% | 2.78% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.40% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 8.90% | 3.33% | 14.44% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608669135 | T -> G | LOC_Os06g15260.1 | upstream_gene_variant ; 2807.0bp to feature; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> G | LOC_Os06g15280.1 | upstream_gene_variant ; 3649.0bp to feature; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> G | LOC_Os06g15270.1 | downstream_gene_variant ; 425.0bp to feature; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> G | LOC_Os06g15260-LOC_Os06g15270 | intergenic_region ; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> A | LOC_Os06g15260.1 | upstream_gene_variant ; 2807.0bp to feature; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> A | LOC_Os06g15280.1 | upstream_gene_variant ; 3649.0bp to feature; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> A | LOC_Os06g15270.1 | downstream_gene_variant ; 425.0bp to feature; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> A | LOC_Os06g15260-LOC_Os06g15270 | intergenic_region ; MODIFIER | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0608669135 | T -> DEL | N | N | silent_mutation | Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608669135 | 2.88E-07 | 1.34E-06 | mr1125 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608669135 | 8.44E-06 | NA | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608669135 | NA | 8.49E-06 | mr1804 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608669135 | 2.90E-06 | 9.15E-07 | mr1971 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |