\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608638903:

Variant ID: vg0608638903 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8638903
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTATCTAATGGCACGCTTAGAGGTCATTAATAGGGCTTTATTTTCGCCGTTTGTTGAGTTTGTCCCATTTCGCGTGTAGTTTCGGAGCCCGAAGACCC[G/A]
CAGTGTGAGGATTTCAAGGATCAAGCTCCAGATCTCGAGCAAGGCAAGCCACCTTTGAACATCTTGAGCCTATATTTGAAATTTAATTATGTTGCTTGAA

Reverse complement sequence

TTCAAGCAACATAATTAAATTTCAAATATAGGCTCAAGATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCTGGAGCTTGATCCTTGAAATCCTCACACTG[C/T]
GGGTCTTCGGGCTCCGAAACTACACGCGAAATGGGACAAACTCAACAAACGGCGAAAATAAAGCCCTATTAATGACCTCTAAGCGTGCCATTAGATAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.10% 13.50% 9.59% 51.82% NA
All Indica  2759 2.10% 1.90% 13.27% 82.78% NA
All Japonica  1512 66.40% 23.50% 3.44% 6.61% NA
Aus  269 3.00% 78.40% 8.55% 10.04% NA
Indica I  595 1.20% 0.20% 14.12% 84.54% NA
Indica II  465 1.50% 2.60% 5.59% 90.32% NA
Indica III  913 2.70% 1.30% 20.04% 75.90% NA
Indica Intermediate  786 2.30% 3.40% 9.29% 84.99% NA
Temperate Japonica  767 79.70% 5.30% 3.13% 11.86% NA
Tropical Japonica  504 39.90% 55.20% 4.17% 0.79% NA
Japonica Intermediate  241 79.70% 15.40% 2.90% 2.07% NA
VI/Aromatic  96 90.60% 4.20% 3.12% 2.08% NA
Intermediate  90 31.10% 18.90% 10.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608638903 G -> A LOC_Os06g15240.1 upstream_gene_variant ; 3400.0bp to feature; MODIFIER silent_mutation Average:6.339; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0608638903 G -> A LOC_Os06g15240-LOC_Os06g15250 intergenic_region ; MODIFIER silent_mutation Average:6.339; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0608638903 G -> DEL N N silent_mutation Average:6.339; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608638903 NA 5.57E-27 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 1.12E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 3.66E-10 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 6.09E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 5.25E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 4.59E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 6.43E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 8.81E-13 mr1951 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 9.50E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 1.13E-07 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 2.55E-08 7.79E-26 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 1.33E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 4.86E-15 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 2.98E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 2.77E-10 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 2.44E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 8.42E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608638903 NA 2.40E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251