\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608636014:

Variant ID: vg0608636014 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8636014
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCACGAGCGCCCTAGCTGAGACGCGGGTCTGAGCGACACGGCAGCAAAAATCTGACGTGGCGCGACTAAGGCACGGTCCAGGTCAACGCACTGTGACA[G/A]
GCCTTAGCGAATACCTGTAACGCACGTGAGCGTGGACGCGAGAGAGAAGAACAGTAATCACATAGAACACAAGTGTTTGGCGCTGCGAACAACTGAGAAG

Reverse complement sequence

CTTCTCAGTTGTTCGCAGCGCCAAACACTTGTGTTCTATGTGATTACTGTTCTTCTCTCTCGCGTCCACGCTCACGTGCGTTACAGGTATTCGCTAAGGC[C/T]
TGTCACAGTGCGTTGACCTGGACCGTGCCTTAGTCGCGCCACGTCAGATTTTTGCTGCCGTGTCGCTCAGACCCGCGTCTCAGCTAGGGCGCTCGTGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.70% 0.11% 0.00% NA
All Indica  2759 96.00% 3.80% 0.18% 0.00% NA
All Japonica  1512 19.90% 80.10% 0.00% 0.00% NA
Aus  269 14.50% 85.50% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.34% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 96.10% 3.90% 0.00% 0.00% NA
Indica Intermediate  786 93.90% 5.70% 0.38% 0.00% NA
Temperate Japonica  767 36.90% 63.10% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608636014 G -> A LOC_Os06g15240.1 upstream_gene_variant ; 511.0bp to feature; MODIFIER silent_mutation Average:40.939; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg0608636014 G -> A LOC_Os06g15240-LOC_Os06g15250 intergenic_region ; MODIFIER silent_mutation Average:40.939; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608636014 6.84E-06 6.84E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608636014 5.29E-06 3.52E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608636014 5.12E-06 5.12E-06 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608636014 NA 1.68E-07 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608636014 NA 4.04E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608636014 9.10E-06 9.09E-06 mr1822_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608636014 3.92E-06 6.20E-06 mr1843_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251