\
| Variant ID: vg0608636014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8636014 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )
AGGCACGAGCGCCCTAGCTGAGACGCGGGTCTGAGCGACACGGCAGCAAAAATCTGACGTGGCGCGACTAAGGCACGGTCCAGGTCAACGCACTGTGACA[G/A]
GCCTTAGCGAATACCTGTAACGCACGTGAGCGTGGACGCGAGAGAGAAGAACAGTAATCACATAGAACACAAGTGTTTGGCGCTGCGAACAACTGAGAAG
CTTCTCAGTTGTTCGCAGCGCCAAACACTTGTGTTCTATGTGATTACTGTTCTTCTCTCTCGCGTCCACGCTCACGTGCGTTACAGGTATTCGCTAAGGC[C/T]
TGTCACAGTGCGTTGACCTGGACCGTGCCTTAGTCGCGCCACGTCAGATTTTTGCTGCCGTGTCGCTCAGACCCGCGTCTCAGCTAGGGCGCTCGTGCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 35.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 3.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 19.90% | 80.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.90% | 5.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 36.90% | 63.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608636014 | G -> A | LOC_Os06g15240.1 | upstream_gene_variant ; 511.0bp to feature; MODIFIER | silent_mutation | Average:40.939; most accessible tissue: Minghui63 young leaf, score: 67.374 | N | N | N | N |
| vg0608636014 | G -> A | LOC_Os06g15240-LOC_Os06g15250 | intergenic_region ; MODIFIER | silent_mutation | Average:40.939; most accessible tissue: Minghui63 young leaf, score: 67.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608636014 | 6.84E-06 | 6.84E-06 | mr1329_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608636014 | 5.29E-06 | 3.52E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608636014 | 5.12E-06 | 5.12E-06 | mr1524_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608636014 | NA | 1.68E-07 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608636014 | NA | 4.04E-06 | mr1578_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608636014 | 9.10E-06 | 9.09E-06 | mr1822_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608636014 | 3.92E-06 | 6.20E-06 | mr1843_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |