Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608598579:

Variant ID: vg0608598579 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8598579
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATCCACACGCGGTCGCCGCGGCGCATGCGTCCCTTGGCCTCGACGTAGGCCAGCTCGTACCACACCGAGCTGCTCGACGTGTTCCCGAATCGGTGGAG[C/T]
GCCATCCGCGACGCCTGCACCTGCTCGTCCGAGAGGCAGAGGCTGCGCTGCAGCTCGTCGATCACCGCCCGCCCGCCGGCGTGGATGCAGAAGTGCTCGA

Reverse complement sequence

TCGAGCACTTCTGCATCCACGCCGGCGGGCGGGCGGTGATCGACGAGCTGCAGCGCAGCCTCTGCCTCTCGGACGAGCAGGTGCAGGCGTCGCGGATGGC[G/A]
CTCCACCGATTCGGGAACACGTCGAGCAGCTCGGTGTGGTACGAGCTGGCCTACGTCGAGGCCAAGGGACGCATGCGCCGCGGCGACCGCGTGTGGATGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	8.60%	0.13%	0.00%	NA
All Indica	2759	98.60%	1.40%	0.00%	0.00%	NA
All Japonica	1512	76.50%	23.10%	0.40%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	2.00%	0.00%	0.00%	NA
Temperate Japonica	767	95.00%	4.80%	0.13%	0.00%	NA
Tropical Japonica	504	43.80%	55.40%	0.79%	0.00%	NA
Japonica Intermediate	241	85.90%	13.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608598579	C -> T	LOC_Os06g15170.1	synonymous_variant ; p.Ala417Ala; LOW	synonymous_codon	Average:83.953; most accessible tissue: Minghui63 flag leaf, score: 95.398	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0608598579	C	T	-0.06	-0.04	-0.04	0.0	-0.03	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608598579	NA	1.82E-18	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608598579	NA	2.22E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608598579	NA	7.67E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608598579	NA	5.21E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608598579	1.85E-06	NA	mr1623_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608598579	NA	6.07E-11	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251