Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608569347:

Variant ID: vg0608569347 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8569347
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.39, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATATGAATTTATATAGAAAACTTTATTTAATCAGTACAGATCAACACACATATGTTTAACAAATTTTAAAAGTAAGTTCAATGTTAACTTCAACACA[T/C]
ATAAGATACATACTATTGCATGTTTCAAATTGAAAGGAGACACTAGATGGAGTATAAACCAGCTACGACTAGCTGTGTAGTCATGTCCAATGAAAAATGC

Reverse complement sequence

GCATTTTTCATTGGACATGACTACACAGCTAGTCGTAGCTGGTTTATACTCCATCTAGTGTCTCCTTTCAATTTGAAACATGCAATAGTATGTATCTTAT[A/G]
TGTGTTGAAGTTAACATTGAACTTACTTTTAAAATTTGTTAAACATATGTGTGTTGATCTGTACTGATTAAATAAAGTTTTCTATATAAATTCATATTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.50%	9.20%	16.72%	32.59%	NA
All Indica	2759	6.30%	12.30%	27.65%	53.68%	NA
All Japonica	1512	93.30%	5.80%	0.53%	0.46%	NA
Aus	269	86.60%	0.00%	0.37%	13.01%	NA
Indica I	595	7.20%	4.70%	32.27%	55.80%	NA
Indica II	465	6.20%	11.80%	31.83%	50.11%	NA
Indica III	913	4.80%	15.70%	19.28%	60.24%	NA
Indica Intermediate	786	7.50%	14.50%	31.42%	46.56%	NA
Temperate Japonica	767	87.70%	11.20%	0.52%	0.52%	NA
Tropical Japonica	504	99.20%	0.00%	0.60%	0.20%	NA
Japonica Intermediate	241	98.30%	0.40%	0.41%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	54.40%	8.90%	20.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608569347	T -> C	LOC_Os06g15110.1	upstream_gene_variant ; 3178.0bp to feature; MODIFIER	silent_mutation	Average:7.935; most accessible tissue: Callus, score: 25.832	N	N	N	N
vg0608569347	T -> C	LOC_Os06g15110-LOC_Os06g15120	intergenic_region ; MODIFIER	silent_mutation	Average:7.935; most accessible tissue: Callus, score: 25.832	N	N	N	N
vg0608569347	T -> DEL	N	N	silent_mutation	Average:7.935; most accessible tissue: Callus, score: 25.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608569347	NA	1.51E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608569347	NA	5.96E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608569347	NA	1.58E-06	mr1875_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608569347	9.90E-07	9.90E-07	mr1908_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608569347	NA	7.24E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251