\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608550861:

Variant ID: vg0608550861 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8550861
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACCACCCGCACACGTGAACGACTACCGACACCGGTACACGGGTACCGGGGTCGACAACCGCACAACGGGTACGGGGCGACAACGAAAGGACAAGGAC[A/G]
GGGCAGCGAGAGGACGGATCCTTACCACCACGCGACAAGGCGTGGGAACGACAACGACGAACGGGCGCGGCGAAGACGGACGGCGAGGGAACGACTTCGG

Reverse complement sequence

CCGAAGTCGTTCCCTCGCCGTCCGTCTTCGCCGCGCCCGTTCGTCGTTGTCGTTCCCACGCCTTGTCGCGTGGTGGTAAGGATCCGTCCTCTCGCTGCCC[T/C]
GTCCTTGTCCTTTCGTTGTCGCCCCGTACCCGTTGTGCGGTTGTCGACCCCGGTACCCGTGTACCGGTGTCGGTAGTCGTTCACGTGTGCGGGTGGTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 5.10% 5.21% 28.54% NA
All Indica  2759 46.10% 1.60% 7.72% 44.62% NA
All Japonica  1512 79.60% 13.20% 1.72% 5.49% NA
Aus  269 94.40% 0.00% 1.12% 4.46% NA
Indica I  595 31.10% 4.00% 4.54% 60.34% NA
Indica II  465 29.90% 1.10% 8.39% 60.65% NA
Indica III  913 67.60% 0.50% 9.53% 22.34% NA
Indica Intermediate  786 42.10% 1.10% 7.63% 49.11% NA
Temperate Japonica  767 61.50% 24.60% 3.26% 10.56% NA
Tropical Japonica  504 98.60% 1.00% 0.20% 0.20% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 1.10% 4.44% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608550861 A -> G LOC_Os06g15080.1 upstream_gene_variant ; 361.0bp to feature; MODIFIER silent_mutation Average:9.397; most accessible tissue: Callus, score: 16.55 N N N N
vg0608550861 A -> G LOC_Os06g15090.1 downstream_gene_variant ; 2051.0bp to feature; MODIFIER silent_mutation Average:9.397; most accessible tissue: Callus, score: 16.55 N N N N
vg0608550861 A -> G LOC_Os06g15070-LOC_Os06g15080 intergenic_region ; MODIFIER silent_mutation Average:9.397; most accessible tissue: Callus, score: 16.55 N N N N
vg0608550861 A -> DEL N N silent_mutation Average:9.397; most accessible tissue: Callus, score: 16.55 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608550861 4.28E-06 4.28E-06 mr1288 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861 NA 3.45E-06 mr1719 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861 NA 3.16E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861 2.46E-07 4.30E-06 mr1371_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861 2.09E-06 NA mr1647_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861 2.63E-06 NA mr1756_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251