Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608550861:

Variant ID: vg0608550861 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8550861
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GTCACCACCCGCACACGTGAACGACTACCGACACCGGTACACGGGTACCGGGGTCGACAACCGCACAACGGGTACGGGGCGACAACGAAAGGACAAGGAC[A/G]
GGGCAGCGAGAGGACGGATCCTTACCACCACGCGACAAGGCGTGGGAACGACAACGACGAACGGGCGCGGCGAAGACGGACGGCGAGGGAACGACTTCGG

Reverse complement sequence

CCGAAGTCGTTCCCTCGCCGTCCGTCTTCGCCGCGCCCGTTCGTCGTTGTCGTTCCCACGCCTTGTCGCGTGGTGGTAAGGATCCGTCCTCTCGCTGCCC[T/C]
GTCCTTGTCCTTTCGTTGTCGCCCCGTACCCGTTGTGCGGTTGTCGACCCCGGTACCCGTGTACCGGTGTCGGTAGTCGTTCACGTGTGCGGGTGGTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	5.10%	5.21%	28.54%	NA
All Indica	2759	46.10%	1.60%	7.72%	44.62%	NA
All Japonica	1512	79.60%	13.20%	1.72%	5.49%	NA
Aus	269	94.40%	0.00%	1.12%	4.46%	NA
Indica I	595	31.10%	4.00%	4.54%	60.34%	NA
Indica II	465	29.90%	1.10%	8.39%	60.65%	NA
Indica III	913	67.60%	0.50%	9.53%	22.34%	NA
Indica Intermediate	786	42.10%	1.10%	7.63%	49.11%	NA
Temperate Japonica	767	61.50%	24.60%	3.26%	10.56%	NA
Tropical Japonica	504	98.60%	1.00%	0.20%	0.20%	NA
Japonica Intermediate	241	97.50%	2.10%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	1.10%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608550861	A -> G	LOC_Os06g15080.1	upstream_gene_variant ; 361.0bp to feature; MODIFIER	silent_mutation	Average:9.397; most accessible tissue: Callus, score: 16.55	N	N	N	N
vg0608550861	A -> G	LOC_Os06g15090.1	downstream_gene_variant ; 2051.0bp to feature; MODIFIER	silent_mutation	Average:9.397; most accessible tissue: Callus, score: 16.55	N	N	N	N
vg0608550861	A -> G	LOC_Os06g15070-LOC_Os06g15080	intergenic_region ; MODIFIER	silent_mutation	Average:9.397; most accessible tissue: Callus, score: 16.55	N	N	N	N
vg0608550861	A -> DEL	N	N	silent_mutation	Average:9.397; most accessible tissue: Callus, score: 16.55	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608550861	4.28E-06	4.28E-06	mr1288	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861	NA	3.45E-06	mr1719	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861	NA	3.16E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861	2.46E-07	4.30E-06	mr1371_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861	2.09E-06	NA	mr1647_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608550861	2.63E-06	NA	mr1756_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251