Variant ID: vg0608550861 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 8550861 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 86. )
GTCACCACCCGCACACGTGAACGACTACCGACACCGGTACACGGGTACCGGGGTCGACAACCGCACAACGGGTACGGGGCGACAACGAAAGGACAAGGAC[A/G]
GGGCAGCGAGAGGACGGATCCTTACCACCACGCGACAAGGCGTGGGAACGACAACGACGAACGGGCGCGGCGAAGACGGACGGCGAGGGAACGACTTCGG
CCGAAGTCGTTCCCTCGCCGTCCGTCTTCGCCGCGCCCGTTCGTCGTTGTCGTTCCCACGCCTTGTCGCGTGGTGGTAAGGATCCGTCCTCTCGCTGCCC[T/C]
GTCCTTGTCCTTTCGTTGTCGCCCCGTACCCGTTGTGCGGTTGTCGACCCCGGTACCCGTGTACCGGTGTCGGTAGTCGTTCACGTGTGCGGGTGGTGAC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 61.10% | 5.10% | 5.21% | 28.54% | NA |
All Indica | 2759 | 46.10% | 1.60% | 7.72% | 44.62% | NA |
All Japonica | 1512 | 79.60% | 13.20% | 1.72% | 5.49% | NA |
Aus | 269 | 94.40% | 0.00% | 1.12% | 4.46% | NA |
Indica I | 595 | 31.10% | 4.00% | 4.54% | 60.34% | NA |
Indica II | 465 | 29.90% | 1.10% | 8.39% | 60.65% | NA |
Indica III | 913 | 67.60% | 0.50% | 9.53% | 22.34% | NA |
Indica Intermediate | 786 | 42.10% | 1.10% | 7.63% | 49.11% | NA |
Temperate Japonica | 767 | 61.50% | 24.60% | 3.26% | 10.56% | NA |
Tropical Japonica | 504 | 98.60% | 1.00% | 0.20% | 0.20% | NA |
Japonica Intermediate | 241 | 97.50% | 2.10% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 68.90% | 1.10% | 4.44% | 25.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0608550861 | A -> G | LOC_Os06g15080.1 | upstream_gene_variant ; 361.0bp to feature; MODIFIER | silent_mutation | Average:9.397; most accessible tissue: Callus, score: 16.55 | N | N | N | N |
vg0608550861 | A -> G | LOC_Os06g15090.1 | downstream_gene_variant ; 2051.0bp to feature; MODIFIER | silent_mutation | Average:9.397; most accessible tissue: Callus, score: 16.55 | N | N | N | N |
vg0608550861 | A -> G | LOC_Os06g15070-LOC_Os06g15080 | intergenic_region ; MODIFIER | silent_mutation | Average:9.397; most accessible tissue: Callus, score: 16.55 | N | N | N | N |
vg0608550861 | A -> DEL | N | N | silent_mutation | Average:9.397; most accessible tissue: Callus, score: 16.55 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0608550861 | 4.28E-06 | 4.28E-06 | mr1288 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608550861 | NA | 3.45E-06 | mr1719 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608550861 | NA | 3.16E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608550861 | 2.46E-07 | 4.30E-06 | mr1371_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608550861 | 2.09E-06 | NA | mr1647_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0608550861 | 2.63E-06 | NA | mr1756_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |