\
| Variant ID: vg0608522054 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8522054 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 80. )
TGTTAAGGTCAACCGTTGTCATCGCACTGTCATCAATCGTTATGCCTCCACCAATCAACCTAACCCATTGGCACCGGAACAGAGGGACCTTGAGAGGACC[G/A]
TAGTCAAGTTCCCATATATCCTCGATGGCACCGTAATACGTGCCAGTTGTTCCATCGTGTCCCATGGCATCGATACGAACAACGCTGTTTTGGTTCGTGC
GCACGAACCAAAACAGCGTTGTTCGTATCGATGCCATGGGACACGATGGAACAACTGGCACGTATTACGGTGCCATCGAGGATATATGGGAACTTGACTA[C/T]
GGTCCTCTCAAGGTCCCTCTGTTCCGGTGCCAATGGGTTAGGTTGATTGGTGGAGGCATAACGATTGATGACAGTGCGATGACAACGGTTGACCTTAACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.70% | 3.00% | 35.15% | 19.23% | NA |
| All Indica | 2759 | 8.00% | 4.70% | 55.85% | 31.39% | NA |
| All Japonica | 1512 | 93.50% | 0.50% | 5.95% | 0.13% | NA |
| Aus | 269 | 86.20% | 0.00% | 1.12% | 12.64% | NA |
| Indica I | 595 | 8.40% | 6.20% | 47.23% | 38.15% | NA |
| Indica II | 465 | 8.20% | 6.70% | 69.89% | 15.27% | NA |
| Indica III | 913 | 6.80% | 1.40% | 48.30% | 43.48% | NA |
| Indica Intermediate | 786 | 9.20% | 6.20% | 62.85% | 21.76% | NA |
| Temperate Japonica | 767 | 88.10% | 0.90% | 10.82% | 0.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 61.10% | 3.30% | 28.89% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608522054 | G -> A | LOC_Os06g15030.1 | synonymous_variant ; p.Tyr342Tyr; LOW | synonymous_codon | Average:6.915; most accessible tissue: Callus, score: 24.406 | N | N | N | N |
| vg0608522054 | G -> DEL | LOC_Os06g15030.1 | N | frameshift_variant | Average:6.915; most accessible tissue: Callus, score: 24.406 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608522054 | NA | 2.92E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 3.88E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 8.63E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 7.48E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 2.65E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 1.20E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 3.48E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 5.58E-63 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 1.58E-39 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 4.37E-13 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 2.42E-25 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 9.36E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 2.41E-23 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 2.41E-15 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | 2.32E-06 | NA | mr1574_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 2.17E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 2.62E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 1.43E-15 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608522054 | NA | 4.28E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |