\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608463692:

Variant ID: vg0608463692 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8463692
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATAGGCCCAAATGTCAACTATGCTACAAGCGTGGACACACGGTAAAAGAATGTCGTTATGATGAAAATTTTGTTGCCGATGAAAGATTTGCAGGACCG[G/A]
CATCCTCGTATGGTGTAGATACCAACTGGTATCTTGACACCGATGAAACAGATCACGTCACCGGTGACATGAAGAAGTTGACTGTTCGTGAAAAGTATCA

Reverse complement sequence

TGATACTTTTCACGAACAGTCAACTTCTTCATGTCACCGGTGACGTGATCTGTTTCATCGGTGTCAAGATACCAGTTGGTATCTACACCATACGAGGATG[C/T]
CGGTCCTGCAAATCTTTCATCGGCAACAAAATTTTCATCATAACGACATTCTTTTACCGTGTGTCCACGCTTGTAGCATAGTTGACATTTGGGCCTATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 14.00% 0.74% 24.84% NA
All Indica  2759 56.10% 2.10% 0.91% 40.81% NA
All Japonica  1512 75.10% 24.50% 0.26% 0.13% NA
Aus  269 7.80% 77.70% 1.49% 13.01% NA
Indica I  595 50.80% 0.50% 1.51% 47.23% NA
Indica II  465 81.10% 2.60% 0.86% 15.48% NA
Indica III  913 41.00% 1.60% 0.55% 56.85% NA
Indica Intermediate  786 63.10% 3.70% 0.89% 32.32% NA
Temperate Japonica  767 94.10% 5.50% 0.26% 0.13% NA
Tropical Japonica  504 41.90% 57.70% 0.20% 0.20% NA
Japonica Intermediate  241 84.20% 15.40% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 4.20% 0.00% 2.08% NA
Intermediate  90 67.80% 20.00% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608463692 G -> A LOC_Os06g14900.1 missense_variant ; p.Ala110Thr; MODERATE nonsynonymous_codon ; A110T Average:26.571; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 unknown unknown TOLERATED 0.42
vg0608463692 G -> DEL LOC_Os06g14900.1 N frameshift_variant Average:26.571; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608463692 NA 3.38E-24 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 3.58E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 3.41E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 1.78E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 2.41E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 7.03E-16 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 2.72E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 3.01E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 5.51E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 2.21E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 8.50E-06 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 2.06E-06 2.70E-18 mr1533_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 7.36E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 2.44E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 8.90E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 8.26E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 1.16E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608463692 NA 1.66E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251