Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608455356:

Variant ID: vg0608455356 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8455356
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGAGGAATCTTTAGTCCCGGTTGATAACACCAACCGGGACTAAAGAGAGAGTAGCGCTTTTTTTTTTCTTTTGCCCAGATTTAATCCCTATATTTTCT[T/C]
CTGAATCTAGTGCCATGTATATCCCTAAATCAATCCTCAAATCCCCAATTTAAAGTAACATCCCAAAGCTTAAGTTATTTATAAACATAAATCAAATACA

Reverse complement sequence

TGTATTTGATTTATGTTTATAAATAACTTAAGCTTTGGGATGTTACTTTAAATTGGGGATTTGAGGATTGATTTAGGGATATACATGGCACTAGATTCAG[A/G]
AGAAAATATAGGGATTAAATCTGGGCAAAAGAAAAAAAAAAGCGCTACTCTCTCTTTAGTCCCGGTTGGTGTTATCAACCGGGACTAAAGATTCCTCTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	0.10%	0.34%	56.94%	NA
All Indica	2759	5.20%	0.20%	0.40%	94.20%	NA
All Japonica	1512	99.00%	0.00%	0.00%	0.99%	NA
Aus	269	85.50%	0.00%	0.37%	14.13%	NA
Indica I	595	4.90%	0.20%	0.67%	94.29%	NA
Indica II	465	5.20%	0.00%	0.22%	94.62%	NA
Indica III	913	4.50%	0.20%	0.44%	94.85%	NA
Indica Intermediate	786	6.40%	0.30%	0.25%	93.13%	NA
Temperate Japonica	767	99.00%	0.00%	0.00%	1.04%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	54.40%	0.00%	4.44%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608455356	T -> C	LOC_Os06g14870.1	upstream_gene_variant ; 1265.0bp to feature; MODIFIER	silent_mutation	Average:23.716; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0608455356	T -> C	LOC_Os06g14890.1	downstream_gene_variant ; 1469.0bp to feature; MODIFIER	silent_mutation	Average:23.716; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0608455356	T -> C	LOC_Os06g14870-LOC_Os06g14890	intergenic_region ; MODIFIER	silent_mutation	Average:23.716; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0608455356	T -> DEL	N	N	silent_mutation	Average:23.716; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608455356	NA	4.29E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608455356	4.73E-06	4.73E-06	mr1370	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608455356	NA	1.17E-25	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608455356	NA	2.98E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251