\
| Variant ID: vg0608454378 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8454378 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )
GTTAGGGGACGATTTTGTATCTCGATGATAAGTTGAGGCACCTTACGTGTACTTTTTCCTATTTTTGCTCCACCTATTCTTATTTGGATGGATTCTATTG[G/A]
GGAATAAGTCCATTTTACCTTCCTTTATCTCTTTGCTCCTGGTTGAATCGTCTCCTGTAACCGTAAAACCGGATATAATTAACATCACCCCTCGTCTTAA
TTAAGACGAGGGGTGATGTTAATTATATCCGGTTTTACGGTTACAGGAGACGATTCAACCAGGAGCAAAGAGATAAAGGAAGGTAAAATGGACTTATTCC[C/T]
CAATAGAATCCATCCAAATAAGAATAGGTGGAGCAAAAATAGGAAAAAGTACACGTAAGGTGCCTCAACTTATCATCGAGATACAAAATCGTCCCCTAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 26.70% | 0.61% | 5.99% | NA |
| All Indica | 2759 | 87.00% | 2.60% | 0.36% | 10.08% | NA |
| All Japonica | 1512 | 38.40% | 60.60% | 0.99% | 0.00% | NA |
| Aus | 269 | 15.20% | 84.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.70% | 1.00% | 0.84% | 15.46% | NA |
| Indica II | 465 | 94.60% | 3.40% | 0.00% | 1.94% | NA |
| Indica III | 913 | 89.30% | 1.50% | 0.22% | 8.98% | NA |
| Indica Intermediate | 786 | 83.00% | 4.60% | 0.38% | 12.09% | NA |
| Temperate Japonica | 767 | 51.20% | 47.80% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 22.40% | 77.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 31.10% | 66.40% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 13.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 36.70% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608454378 | G -> A | LOC_Os06g14870.1 | upstream_gene_variant ; 287.0bp to feature; MODIFIER | silent_mutation | Average:53.414; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0608454378 | G -> A | LOC_Os06g14890.1 | downstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:53.414; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0608454378 | G -> A | LOC_Os06g14870-LOC_Os06g14890 | intergenic_region ; MODIFIER | silent_mutation | Average:53.414; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0608454378 | G -> DEL | N | N | silent_mutation | Average:53.414; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608454378 | NA | 7.13E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 6.36E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 2.97E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 1.65E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 1.14E-10 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 8.59E-09 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 5.93E-12 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | 5.67E-06 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 2.15E-11 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 6.21E-15 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | 1.14E-06 | NA | mr1617_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 8.83E-13 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 1.80E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608454378 | NA | 7.61E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |