\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608451968:

Variant ID: vg0608451968 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8451968
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAATTCCGAATTACAGTTAATTTTAAATTGTATTCCTACTTCAAATCTTCTTTTCTTTTCTTTTTTTTGGCTAATTTTGGATTTTCTTTTTATTCT[G/A]
AATATTAATTAATCTCGTATTGTGTTCTTATATGGACTCTTCTTTCCATATTTTTTATTTTTAATTCCGAATTTCAATTATTTTTAAATTGTATTCCTAC

Reverse complement sequence

GTAGGAATACAATTTAAAAATAATTGAAATTCGGAATTAAAAATAAAAAATATGGAAAGAAGAGTCCATATAAGAACACAATACGAGATTAATTAATATT[C/T]
AGAATAAAAAGAAAATCCAAAATTAGCCAAAAAAAAGAAAAGAAAAGAAGATTTGAAGTAGGAATACAATTTAAAATTAACTGTAATTCGGAATTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 14.00% 1.02% 7.19% NA
All Indica  2759 85.90% 1.70% 0.29% 12.11% NA
All Japonica  1512 73.60% 24.10% 2.18% 0.07% NA
Aus  269 16.00% 83.30% 0.74% 0.00% NA
Indica I  595 79.80% 0.00% 0.17% 20.00% NA
Indica II  465 94.20% 2.20% 0.22% 3.44% NA
Indica III  913 89.50% 1.10% 0.44% 8.98% NA
Indica Intermediate  786 81.40% 3.40% 0.25% 14.89% NA
Temperate Japonica  767 93.20% 5.50% 1.17% 0.13% NA
Tropical Japonica  504 40.50% 56.50% 2.98% 0.00% NA
Japonica Intermediate  241 80.50% 15.80% 3.73% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 68.90% 21.10% 4.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608451968 G -> A LOC_Os06g14860.1 upstream_gene_variant ; 2690.0bp to feature; MODIFIER silent_mutation Average:21.55; most accessible tissue: Callus, score: 38.311 N N N N
vg0608451968 G -> A LOC_Os06g14870.1 downstream_gene_variant ; 1138.0bp to feature; MODIFIER silent_mutation Average:21.55; most accessible tissue: Callus, score: 38.311 N N N N
vg0608451968 G -> A LOC_Os06g14890.1 downstream_gene_variant ; 4857.0bp to feature; MODIFIER silent_mutation Average:21.55; most accessible tissue: Callus, score: 38.311 N N N N
vg0608451968 G -> A LOC_Os06g14860-LOC_Os06g14870 intergenic_region ; MODIFIER silent_mutation Average:21.55; most accessible tissue: Callus, score: 38.311 N N N N
vg0608451968 G -> DEL N N silent_mutation Average:21.55; most accessible tissue: Callus, score: 38.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608451968 NA 4.19E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 3.26E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 7.00E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 1.95E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 4.19E-15 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 1.31E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 9.32E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 7.89E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 5.58E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 1.01E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 9.44E-07 NA mr1526_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 9.16E-06 2.28E-16 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 6.60E-15 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 4.12E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 5.95E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 2.08E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 2.45E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968 NA 1.48E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251