Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608451968:

Variant ID: vg0608451968 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8451968
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTAATTCCGAATTACAGTTAATTTTAAATTGTATTCCTACTTCAAATCTTCTTTTCTTTTCTTTTTTTTGGCTAATTTTGGATTTTCTTTTTATTCT[G/A]
AATATTAATTAATCTCGTATTGTGTTCTTATATGGACTCTTCTTTCCATATTTTTTATTTTTAATTCCGAATTTCAATTATTTTTAAATTGTATTCCTAC

Reverse complement sequence

GTAGGAATACAATTTAAAAATAATTGAAATTCGGAATTAAAAATAAAAAATATGGAAAGAAGAGTCCATATAAGAACACAATACGAGATTAATTAATATT[C/T]
AGAATAAAAAGAAAATCCAAAATTAGCCAAAAAAAAGAAAAGAAAAGAAGATTTGAAGTAGGAATACAATTTAAAATTAACTGTAATTCGGAATTAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.80%	14.00%	1.02%	7.19%	NA
All Indica	2759	85.90%	1.70%	0.29%	12.11%	NA
All Japonica	1512	73.60%	24.10%	2.18%	0.07%	NA
Aus	269	16.00%	83.30%	0.74%	0.00%	NA
Indica I	595	79.80%	0.00%	0.17%	20.00%	NA
Indica II	465	94.20%	2.20%	0.22%	3.44%	NA
Indica III	913	89.50%	1.10%	0.44%	8.98%	NA
Indica Intermediate	786	81.40%	3.40%	0.25%	14.89%	NA
Temperate Japonica	767	93.20%	5.50%	1.17%	0.13%	NA
Tropical Japonica	504	40.50%	56.50%	2.98%	0.00%	NA
Japonica Intermediate	241	80.50%	15.80%	3.73%	0.00%	NA
VI/Aromatic	96	93.80%	5.20%	1.04%	0.00%	NA
Intermediate	90	68.90%	21.10%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608451968	G -> A	LOC_Os06g14860.1	upstream_gene_variant ; 2690.0bp to feature; MODIFIER	silent_mutation	Average:21.55; most accessible tissue: Callus, score: 38.311	N	N	N	N
vg0608451968	G -> A	LOC_Os06g14870.1	downstream_gene_variant ; 1138.0bp to feature; MODIFIER	silent_mutation	Average:21.55; most accessible tissue: Callus, score: 38.311	N	N	N	N
vg0608451968	G -> A	LOC_Os06g14890.1	downstream_gene_variant ; 4857.0bp to feature; MODIFIER	silent_mutation	Average:21.55; most accessible tissue: Callus, score: 38.311	N	N	N	N
vg0608451968	G -> A	LOC_Os06g14860-LOC_Os06g14870	intergenic_region ; MODIFIER	silent_mutation	Average:21.55; most accessible tissue: Callus, score: 38.311	N	N	N	N
vg0608451968	G -> DEL	N	N	silent_mutation	Average:21.55; most accessible tissue: Callus, score: 38.311	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608451968	NA	4.19E-22	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	3.26E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	7.00E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	1.95E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	4.19E-15	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	1.31E-09	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	9.32E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	7.89E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	5.58E-19	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	1.01E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	9.44E-07	NA	mr1526_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	9.16E-06	2.28E-16	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	6.60E-15	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	4.12E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	5.95E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	2.08E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	2.45E-07	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608451968	NA	1.48E-11	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251