\
| Variant ID: vg0608355357 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8355357 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 245. )
AAGACAAATCTGGCATCAATTTTTCTATATAAACGTTGTATGTTGGTTATTGCTGTGTATAACAAAGGATCAAGATTGAAGCGAGCTAGCTGACACAAGA[A/G]
CAGTGAAGCTTAGCCTTCTAATCTTTTATTTTTTATGTATTTTGTTACGAGACTTGGAGTTTCAGTATTATTGTAACTTTTGGCTATATGTATCCACTTA
TAAGTGGATACATATAGCCAAAAGTTACAATAATACTGAAACTCCAAGTCTCGTAACAAAATACATAAAAAATAAAAGATTAGAAGGCTAAGCTTCACTG[T/C]
TCTTGTGTCAGCTAGCTCGCTTCAATCTTGATCCTTTGTTATACACAGCAATAACCAACATACAACGTTTATATAGAAAAATTGATGCCAGATTTGTCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.30% | 22.60% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 41.50% | 58.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 72.90% | 27.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 23.20% | 75.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 36.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608355357 | A -> G | LOC_Os06g14750-LOC_Os06g14770 | intergenic_region ; MODIFIER | silent_mutation | Average:44.468; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608355357 | NA | 5.01E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | NA | 2.57E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | NA | 1.76E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | 3.02E-06 | 9.36E-20 | mr1281_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | NA | 2.61E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | NA | 2.22E-16 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | NA | 2.08E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | NA | 1.76E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | 1.30E-08 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | 4.15E-06 | NA | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608355357 | 5.09E-07 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |