\
| Variant ID: vg0608352038 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 8352038 |
| Reference Allele: TA | Alternative Allele: AA,T |
| Primary Allele: TA | Secondary Allele: AA |
Inferred Ancestral Allele: Not determined.
CTTGAACATTTAGCTAGAGCAAATTGTTTCATGTAAATGAGACATGTCATTAACGAATAATTAATTAAGTAAACATGAAAAATTGATTTGCTTATTTTTT[TA/AA,T]
AAAAAGCTTATAAATATACTACCTCCGTTCCAAAATAAGTGCAGCCATATATATTCGTGTTTAGCATTTTGACCGTTCGTCTTATTTGAAAATTTTATGA
TCATAAAATTTTCAAATAAGACGAACGGTCAAAATGCTAAACACGAATATATATGGCTGCACTTATTTTGGAACGGAGGTAGTATATTTATAAGCTTTTT[TA/TT,A]
AAAAAATAAGCAAATCAATTTTTCATGTTTACTTAATTAATTATTCGTTAATGACATGTCTCATTTACATGAAACAATTTGCTCTAGCTAAATGTTCAAG
| Populations | Population Size | Frequency of TA(primary allele) | Frequency of AA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.50% | 0.25% | 0.00% | T: 0.02% |
| All Indica | 2759 | 98.20% | 1.60% | 0.14% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 44.70% | 54.80% | 0.46% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.34% | 0.00% | T: 0.17% |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 72.90% | 26.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 11.50% | 88.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.50% | 74.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608352038 | TA -> AA | LOC_Os06g14750-LOC_Os06g14770 | intergenic_region ; MODIFIER | silent_mutation | Average:38.507; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg0608352038 | TA -> T | LOC_Os06g14750-LOC_Os06g14770 | intergenic_region ; MODIFIER | silent_mutation | Average:38.507; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608352038 | NA | 3.06E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 1.23E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 2.06E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 3.52E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | 3.65E-06 | 3.39E-20 | mr1281_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 2.64E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 1.11E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 7.99E-17 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 6.65E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | NA | 3.00E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | 5.64E-07 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608352038 | 7.06E-06 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |