Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608160464:

Variant ID: vg0608160464 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8160464
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.04, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGAAACGGAAACATGTCGGTACAGATCGGAAACCGGTAACAAATACGGAAACATTAAACTATAAAAACATATATTTAACCTTACATAAGTATGTTATA[T/A]
ATATATACATAAATTCAAGCTTATACTATATAAATTATAAATTAACTTCATTTTAGCCATGTACAAAAGTTAGAGATTTTATTGAAGAGCCATTCAATCT

Reverse complement sequence

AGATTGAATGGCTCTTCAATAAAATCTCTAACTTTTGTACATGGCTAAAATGAAGTTAATTTATAATTTATATAGTATAAGCTTGAATTTATGTATATAT[A/T]
TATAACATACTTATGTAAGGTTAAATATATGTTTTTATAGTTTAATGTTTCCGTATTTGTTACCGGTTTCCGATCTGTACCGACATGTTTCCGTTTCCGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.20%	30.30%	0.40%	24.04%	NA
All Indica	2759	66.20%	32.20%	0.07%	1.52%	NA
All Japonica	1512	17.70%	17.70%	0.66%	63.96%	NA
Aus	269	0.70%	92.60%	0.74%	5.95%	NA
Indica I	595	55.80%	44.00%	0.17%	0.00%	NA
Indica II	465	91.20%	6.20%	0.00%	2.58%	NA
Indica III	913	55.00%	43.40%	0.00%	1.64%	NA
Indica Intermediate	786	72.30%	25.70%	0.13%	1.91%	NA
Temperate Japonica	767	28.30%	30.90%	0.65%	40.16%	NA
Tropical Japonica	504	2.20%	2.20%	0.79%	94.84%	NA
Japonica Intermediate	241	16.20%	8.30%	0.41%	75.10%	NA
VI/Aromatic	96	1.00%	8.30%	3.12%	87.50%	NA
Intermediate	90	46.70%	21.10%	2.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608160464	T -> A	LOC_Os06g14510.1	downstream_gene_variant ; 1079.0bp to feature; MODIFIER	silent_mutation	Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632	N	N	N	N
vg0608160464	T -> A	LOC_Os06g14520.1	downstream_gene_variant ; 3063.0bp to feature; MODIFIER	silent_mutation	Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632	N	N	N	N
vg0608160464	T -> A	LOC_Os06g14510.3	downstream_gene_variant ; 1079.0bp to feature; MODIFIER	silent_mutation	Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632	N	N	N	N
vg0608160464	T -> A	LOC_Os06g14510.2	downstream_gene_variant ; 1079.0bp to feature; MODIFIER	silent_mutation	Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632	N	N	N	N
vg0608160464	T -> A	LOC_Os06g14510-LOC_Os06g14520	intergenic_region ; MODIFIER	silent_mutation	Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632	N	N	N	N
vg0608160464	T -> DEL	N	N	silent_mutation	Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608160464	NA	6.79E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	7.76E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	8.08E-08	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	1.86E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	2.61E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	2.16E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	2.30E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	4.25E-06	4.24E-06	mr1387_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	6.15E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	9.85E-06	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	7.72E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	5.40E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	3.59E-16	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	3.57E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	1.86E-08	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	3.18E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	5.54E-09	mr1668_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	2.60E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	6.18E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	8.28E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464	NA	3.60E-07	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251