\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608160464:

Variant ID: vg0608160464 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8160464
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.04, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGAAACGGAAACATGTCGGTACAGATCGGAAACCGGTAACAAATACGGAAACATTAAACTATAAAAACATATATTTAACCTTACATAAGTATGTTATA[T/A]
ATATATACATAAATTCAAGCTTATACTATATAAATTATAAATTAACTTCATTTTAGCCATGTACAAAAGTTAGAGATTTTATTGAAGAGCCATTCAATCT

Reverse complement sequence

AGATTGAATGGCTCTTCAATAAAATCTCTAACTTTTGTACATGGCTAAAATGAAGTTAATTTATAATTTATATAGTATAAGCTTGAATTTATGTATATAT[A/T]
TATAACATACTTATGTAAGGTTAAATATATGTTTTTATAGTTTAATGTTTCCGTATTTGTTACCGGTTTCCGATCTGTACCGACATGTTTCCGTTTCCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 30.30% 0.40% 24.04% NA
All Indica  2759 66.20% 32.20% 0.07% 1.52% NA
All Japonica  1512 17.70% 17.70% 0.66% 63.96% NA
Aus  269 0.70% 92.60% 0.74% 5.95% NA
Indica I  595 55.80% 44.00% 0.17% 0.00% NA
Indica II  465 91.20% 6.20% 0.00% 2.58% NA
Indica III  913 55.00% 43.40% 0.00% 1.64% NA
Indica Intermediate  786 72.30% 25.70% 0.13% 1.91% NA
Temperate Japonica  767 28.30% 30.90% 0.65% 40.16% NA
Tropical Japonica  504 2.20% 2.20% 0.79% 94.84% NA
Japonica Intermediate  241 16.20% 8.30% 0.41% 75.10% NA
VI/Aromatic  96 1.00% 8.30% 3.12% 87.50% NA
Intermediate  90 46.70% 21.10% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608160464 T -> A LOC_Os06g14510.1 downstream_gene_variant ; 1079.0bp to feature; MODIFIER silent_mutation Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0608160464 T -> A LOC_Os06g14520.1 downstream_gene_variant ; 3063.0bp to feature; MODIFIER silent_mutation Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0608160464 T -> A LOC_Os06g14510.3 downstream_gene_variant ; 1079.0bp to feature; MODIFIER silent_mutation Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0608160464 T -> A LOC_Os06g14510.2 downstream_gene_variant ; 1079.0bp to feature; MODIFIER silent_mutation Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0608160464 T -> A LOC_Os06g14510-LOC_Os06g14520 intergenic_region ; MODIFIER silent_mutation Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0608160464 T -> DEL N N silent_mutation Average:28.923; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608160464 NA 6.79E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 7.76E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 8.08E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 1.86E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 2.61E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 2.16E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 2.30E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 4.25E-06 4.24E-06 mr1387_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 6.15E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 9.85E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 7.72E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 5.40E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 3.59E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 3.57E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 1.86E-08 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 3.18E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 5.54E-09 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 2.60E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 6.18E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 8.28E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160464 NA 3.60E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251