Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608151572:

Variant ID: vg0608151572 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8151572
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCAAACGGACCTAGCGTTTTCATGCCAACTCTGATTTGGATGATCTTGGACTTCGTGGAAAGCTTATCTCGCTACCTTTCAAACGCATCTGGTCTCAT[G/A]
TCTAAATTCATCTCGAGTCAACGGGAATCGCCAAAACAAGACAGTGCTGTTGCTGAAACCAAACTTGGGCCTTAGGCCTTGTAATAGACTAGACCCATCT

Reverse complement sequence

AGATGGGTCTAGTCTATTACAAGGCCTAAGGCCCAAGTTTGGTTTCAGCAACAGCACTGTCTTGTTTTGGCGATTCCCGTTGACTCGAGATGAATTTAGA[C/T]
ATGAGACCAGATGCGTTTGAAAGGTAGCGAGATAAGCTTTCCACGAAGTCCAAGATCATCCAAATCAGAGTTGGCATGAAAACGCTAGGTCCGTTTGAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	11.00%	0.00%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	84.30%	15.70%	0.00%	0.00%	NA
Aus	269	10.00%	90.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	97.80%	2.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	73.30%	26.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608151572	G -> A	LOC_Os06g14500.1	upstream_gene_variant ; 2423.0bp to feature; MODIFIER	silent_mutation	Average:50.919; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N
vg0608151572	G -> A	LOC_Os06g14510.1	upstream_gene_variant ; 663.0bp to feature; MODIFIER	silent_mutation	Average:50.919; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N
vg0608151572	G -> A	LOC_Os06g14510.3	upstream_gene_variant ; 1047.0bp to feature; MODIFIER	silent_mutation	Average:50.919; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N
vg0608151572	G -> A	LOC_Os06g14510.2	upstream_gene_variant ; 1051.0bp to feature; MODIFIER	silent_mutation	Average:50.919; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N
vg0608151572	G -> A	LOC_Os06g14490.1	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:50.919; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N
vg0608151572	G -> A	LOC_Os06g14490.2	downstream_gene_variant ; 4487.0bp to feature; MODIFIER	silent_mutation	Average:50.919; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N
vg0608151572	G -> A	LOC_Os06g14500-LOC_Os06g14510	intergenic_region ; MODIFIER	silent_mutation	Average:50.919; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608151572	NA	7.23E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	5.56E-09	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	3.77E-10	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	1.93E-06	mr1469_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	8.34E-07	NA	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	2.53E-06	mr1505_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	8.40E-10	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	2.32E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	1.07E-08	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	9.84E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	3.35E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	5.24E-06	NA	mr1711_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	9.93E-06	9.93E-06	mr1711_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	1.20E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	3.88E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	7.68E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	5.21E-16	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	1.87E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	NA	3.17E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608151572	6.03E-06	NA	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251