\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608150754:

Variant ID: vg0608150754 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8150754
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGGAAAACAAGGGAGGAGGAAAGTTAGGAACTCTAAGGCTATAGCCAACGCAAGGTATAGCCCCATAAAAAAGGTGATGCCAAGTGGGATGAAACGTG[T/C]
GAAGGCCATACCACCATCTCATTTCTGTGATTCAGTACCTATCACTTGGTTACATTTTTCATTTAAACCCTTAATTTATTTTTATTTGTATATACGTCCA

Reverse complement sequence

TGGACGTATATACAAATAAAAATAAATTAAGGGTTTAAATGAAAAATGTAACCAAGTGATAGGTACTGAATCACAGAAATGAGATGGTGGTATGGCCTTC[A/G]
CACGTTTCATCCCACTTGGCATCACCTTTTTTATGGGGCTATACCTTGCGTTGGCTATAGCCTTAGAGTTCCTAACTTTCCTCCTCCCTTGTTTTCCGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 39.80% 11.26% 9.04% NA
All Indica  2759 66.00% 15.20% 10.11% 8.74% NA
All Japonica  1512 1.50% 77.50% 11.31% 9.72% NA
Aus  269 0.70% 72.90% 17.47% 8.92% NA
Indica I  595 55.60% 16.00% 18.82% 9.58% NA
Indica II  465 91.00% 5.80% 1.51% 1.72% NA
Indica III  913 54.80% 21.10% 9.97% 14.13% NA
Indica Intermediate  786 72.10% 13.10% 8.78% 5.98% NA
Temperate Japonica  767 1.30% 84.00% 10.56% 4.17% NA
Tropical Japonica  504 1.40% 70.00% 11.31% 17.26% NA
Japonica Intermediate  241 2.10% 72.60% 13.69% 11.62% NA
VI/Aromatic  96 0.00% 70.80% 19.79% 9.38% NA
Intermediate  90 44.40% 31.10% 17.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608150754 T -> C LOC_Os06g14500.1 upstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N
vg0608150754 T -> C LOC_Os06g14510.1 upstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N
vg0608150754 T -> C LOC_Os06g14510.3 upstream_gene_variant ; 1865.0bp to feature; MODIFIER silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N
vg0608150754 T -> C LOC_Os06g14510.2 upstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N
vg0608150754 T -> C LOC_Os06g14490.1 downstream_gene_variant ; 3618.0bp to feature; MODIFIER silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N
vg0608150754 T -> C LOC_Os06g14490.2 downstream_gene_variant ; 3669.0bp to feature; MODIFIER silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N
vg0608150754 T -> C LOC_Os06g14500-LOC_Os06g14510 intergenic_region ; MODIFIER silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N
vg0608150754 T -> DEL N N silent_mutation Average:78.505; most accessible tissue: Zhenshan97 flower, score: 92.299 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608150754 T C -0.01 0.0 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608150754 NA 1.46E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 6.88E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 1.59E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 1.37E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 5.68E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 6.02E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 1.73E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 3.71E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 9.74E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 5.26E-14 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 2.09E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 4.63E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 1.26E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 5.67E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 1.52E-13 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 6.80E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 9.64E-07 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 2.60E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 2.46E-06 NA mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 1.93E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 7.81E-26 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 6.62E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 2.27E-06 1.43E-07 mr1555_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 3.33E-17 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 7.63E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 8.82E-06 NA mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 2.64E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 5.10E-08 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 3.74E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 1.51E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 2.88E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 5.44E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 7.99E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608150754 NA 4.01E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251