Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608145993:

Variant ID: vg0608145993 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8145993
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGGATCTCAAAACATTAGGTTCTTGATTGTTTACTTGAACCATCAAGCATAAACTTTTGATTTCTACAAAGATGCATGTACGTTTGATCAATACTTC[T/C]
GATGCGATTTTTCTATGCTCTAAAAGCACAAGGCTGAAAGACAAATGCTATTTTTATGATCTCTTGGTTTATCCATAATCATGGCTGGATAATTAAATTT

Reverse complement sequence

AAATTTAATTATCCAGCCATGATTATGGATAAACCAAGAGATCATAAAAATAGCATTTGTCTTTCAGCCTTGTGCTTTTAGAGCATAGAAAAATCGCATC[A/G]
GAAGTATTGATCAAACGTACATGCATCTTTGTAGAAATCAAAAGTTTATGCTTGATGGTTCAAGTAAACAATCAAGAACCTAATGTTTTGAGATCCACTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	49.30%	0.08%	0.13%	NA
All Indica	2759	66.20%	33.70%	0.07%	0.07%	NA
All Japonica	1512	33.80%	65.90%	0.07%	0.26%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	56.00%	44.00%	0.00%	0.00%	NA
Indica II	465	91.00%	8.80%	0.00%	0.22%	NA
Indica III	913	54.80%	45.00%	0.22%	0.00%	NA
Indica Intermediate	786	72.50%	27.40%	0.00%	0.13%	NA
Temperate Japonica	767	58.30%	41.70%	0.00%	0.00%	NA
Tropical Japonica	504	2.20%	97.20%	0.20%	0.40%	NA
Japonica Intermediate	241	22.00%	77.20%	0.00%	0.83%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608145993	T -> C	LOC_Os06g14480.1	upstream_gene_variant ; 4740.0bp to feature; MODIFIER	silent_mutation	Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56	N	N	N	N
vg0608145993	T -> C	LOC_Os06g14500.1	downstream_gene_variant ; 1966.0bp to feature; MODIFIER	silent_mutation	Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56	N	N	N	N
vg0608145993	T -> C	LOC_Os06g14490.1	intron_variant ; MODIFIER	silent_mutation	Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56	N	N	N	N
vg0608145993	T -> C	LOC_Os06g14490.2	intron_variant ; MODIFIER	silent_mutation	Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56	N	N	N	N
vg0608145993	T -> DEL	N	N	silent_mutation	Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608145993	NA	7.82E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	2.17E-06	mr1570	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	2.34E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	3.32E-06	NA	mr1030_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	7.85E-10	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	1.98E-07	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	5.40E-08	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	9.91E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	4.38E-08	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	1.42E-07	mr1331_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	4.29E-07	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	9.87E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	1.41E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	3.37E-06	1.09E-23	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	1.13E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	1.83E-19	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	9.68E-06	2.82E-09	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	2.85E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	3.08E-08	mr1668_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	6.06E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	2.39E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	6.07E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	NA	1.58E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993	1.85E-06	7.52E-08	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251