\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608145993:

Variant ID: vg0608145993 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8145993
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGGATCTCAAAACATTAGGTTCTTGATTGTTTACTTGAACCATCAAGCATAAACTTTTGATTTCTACAAAGATGCATGTACGTTTGATCAATACTTC[T/C]
GATGCGATTTTTCTATGCTCTAAAAGCACAAGGCTGAAAGACAAATGCTATTTTTATGATCTCTTGGTTTATCCATAATCATGGCTGGATAATTAAATTT

Reverse complement sequence

AAATTTAATTATCCAGCCATGATTATGGATAAACCAAGAGATCATAAAAATAGCATTTGTCTTTCAGCCTTGTGCTTTTAGAGCATAGAAAAATCGCATC[A/G]
GAAGTATTGATCAAACGTACATGCATCTTTGTAGAAATCAAAAGTTTATGCTTGATGGTTCAAGTAAACAATCAAGAACCTAATGTTTTGAGATCCACTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.30% 0.08% 0.13% NA
All Indica  2759 66.20% 33.70% 0.07% 0.07% NA
All Japonica  1512 33.80% 65.90% 0.07% 0.26% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 56.00% 44.00% 0.00% 0.00% NA
Indica II  465 91.00% 8.80% 0.00% 0.22% NA
Indica III  913 54.80% 45.00% 0.22% 0.00% NA
Indica Intermediate  786 72.50% 27.40% 0.00% 0.13% NA
Temperate Japonica  767 58.30% 41.70% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.20% 0.20% 0.40% NA
Japonica Intermediate  241 22.00% 77.20% 0.00% 0.83% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608145993 T -> C LOC_Os06g14480.1 upstream_gene_variant ; 4740.0bp to feature; MODIFIER silent_mutation Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0608145993 T -> C LOC_Os06g14500.1 downstream_gene_variant ; 1966.0bp to feature; MODIFIER silent_mutation Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0608145993 T -> C LOC_Os06g14490.1 intron_variant ; MODIFIER silent_mutation Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0608145993 T -> C LOC_Os06g14490.2 intron_variant ; MODIFIER silent_mutation Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0608145993 T -> DEL N N silent_mutation Average:50.877; most accessible tissue: Minghui63 flower, score: 69.56 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608145993 NA 7.82E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 2.17E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 2.34E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 3.32E-06 NA mr1030_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 7.85E-10 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 1.98E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 5.40E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 9.91E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 4.38E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 1.42E-07 mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 4.29E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 9.87E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 1.41E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 3.37E-06 1.09E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 1.13E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 1.83E-19 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 9.68E-06 2.82E-09 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 2.85E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 3.08E-08 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 6.06E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 2.39E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 6.07E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 NA 1.58E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608145993 1.85E-06 7.52E-08 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251