\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608137746:

Variant ID: vg0608137746 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8137746
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GATACTGATTCCACCTAGTATCCTAATTTTTATAGTATCTCGATCCTACTATTTATTACTACATGATCCTACGAAATCTTAGGTGGTATCCCGATTCCAC[G/A]
ATCCCTACGATAATACAAAATATTATTTAAAATAACATGGTTTGAAAATAATTTAAATAAATATGCTTAAATTTATATAAAAATCAGTTAAATATATTAA

Reverse complement sequence

TTAATATATTTAACTGATTTTTATATAAATTTAAGCATATTTATTTAAATTATTTTCAAACCATGTTATTTTAAATAATATTTTGTATTATCGTAGGGAT[C/T]
GTGGAATCGGGATACCACCTAAGATTTCGTAGGATCATGTAGTAATAAATAGTAGGATCGAGATACTATAAAAATTAGGATACTAGGTGGAATCAGTATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 40.50% 0.21% 0.00% NA
All Indica  2759 34.10% 65.60% 0.29% 0.00% NA
All Japonica  1512 98.60% 1.30% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 44.50% 55.10% 0.34% 0.00% NA
Indica II  465 9.20% 90.50% 0.22% 0.00% NA
Indica III  913 45.20% 54.30% 0.44% 0.00% NA
Indica Intermediate  786 28.00% 71.90% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608137746 G -> A LOC_Os06g14470.1 upstream_gene_variant ; 3255.0bp to feature; MODIFIER silent_mutation Average:87.934; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0608137746 G -> A LOC_Os06g14490.1 upstream_gene_variant ; 4905.0bp to feature; MODIFIER silent_mutation Average:87.934; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0608137746 G -> A LOC_Os06g14470.2 upstream_gene_variant ; 3255.0bp to feature; MODIFIER silent_mutation Average:87.934; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0608137746 G -> A LOC_Os06g14490.2 upstream_gene_variant ; 4905.0bp to feature; MODIFIER silent_mutation Average:87.934; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0608137746 G -> A LOC_Os06g14480.1 downstream_gene_variant ; 3250.0bp to feature; MODIFIER silent_mutation Average:87.934; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0608137746 G -> A LOC_Os06g14470-LOC_Os06g14480 intergenic_region ; MODIFIER silent_mutation Average:87.934; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608137746 G A 0.01 0.0 -0.01 -0.01 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608137746 NA 1.57E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 4.01E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 4.21E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 6.02E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 3.96E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 8.17E-07 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 5.98E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 3.93E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 1.82E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 8.71E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 6.67E-13 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 1.17E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 2.38E-09 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 3.46E-19 mr1578_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 1.55E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 1.27E-07 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 4.27E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 1.93E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608137746 NA 9.64E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251