\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608135057:

Variant ID: vg0608135057 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8135057
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTACGTCATCCGTGTATGAGTCGGTTTTTAAGTTTGTTTGTTTTTGGAAATACATATCCGTATTTGAGTTAGTTTATAAGATCGTTCACTTTTGGTAATC[A/G]
AAGAAATCATATAAGAAATCTGTTTAAAAAAACTCGCATGCTAATTTGAGACGATCGGACTCCTAACTGCAGCTCATGATTTTCTAAAAATGTATATATC

Reverse complement sequence

GATATATACATTTTTAGAAAATCATGAGCTGCAGTTAGGAGTCCGATCGTCTCAAATTAGCATGCGAGTTTTTTTAAACAGATTTCTTATATGATTTCTT[T/C]
GATTACCAAAAGTGAACGATCTTATAAACTAACTCAAATACGGATATGTATTTCCAAAAACAAACAAACTTAAAAACCGACTCATACACGGATGACGTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 31.10% 0.15% 17.77% NA
All Indica  2759 66.70% 2.90% 0.22% 30.23% NA
All Japonica  1512 34.30% 65.60% 0.07% 0.07% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 56.50% 0.20% 0.34% 43.03% NA
Indica II  465 91.20% 2.60% 0.00% 6.24% NA
Indica III  913 55.50% 3.70% 0.22% 40.53% NA
Indica Intermediate  786 72.90% 4.10% 0.25% 22.77% NA
Temperate Japonica  767 58.50% 41.30% 0.13% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 22.80% 76.80% 0.00% 0.41% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 52.20% 42.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608135057 A -> G LOC_Os06g14470.1 upstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:18.661; most accessible tissue: Callus, score: 48.82 N N N N
vg0608135057 A -> G LOC_Os06g14470.2 upstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:18.661; most accessible tissue: Callus, score: 48.82 N N N N
vg0608135057 A -> G LOC_Os06g14470-LOC_Os06g14480 intergenic_region ; MODIFIER silent_mutation Average:18.661; most accessible tissue: Callus, score: 48.82 N N N N
vg0608135057 A -> DEL N N silent_mutation Average:18.661; most accessible tissue: Callus, score: 48.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608135057 NA 5.96E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.25E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.49E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 2.54E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 7.18E-06 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 3.14E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.58E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.86E-22 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 3.19E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.20E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 3.22E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.64E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 2.89E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.98E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.42E-07 mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 4.36E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 3.02E-06 1.40E-29 mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.13E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 6.07E-21 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 2.85E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 5.34E-14 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 2.37E-16 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 1.76E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 7.98E-12 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 2.39E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 7.83E-06 NA mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 2.11E-07 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 2.65E-06 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 8.83E-32 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 4.80E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057 NA 4.80E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251