Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608135057:

Variant ID: vg0608135057 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8135057
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTACGTCATCCGTGTATGAGTCGGTTTTTAAGTTTGTTTGTTTTTGGAAATACATATCCGTATTTGAGTTAGTTTATAAGATCGTTCACTTTTGGTAATC[A/G]
AAGAAATCATATAAGAAATCTGTTTAAAAAAACTCGCATGCTAATTTGAGACGATCGGACTCCTAACTGCAGCTCATGATTTTCTAAAAATGTATATATC

Reverse complement sequence

GATATATACATTTTTAGAAAATCATGAGCTGCAGTTAGGAGTCCGATCGTCTCAAATTAGCATGCGAGTTTTTTTAAACAGATTTCTTATATGATTTCTT[T/C]
GATTACCAAAAGTGAACGATCTTATAAACTAACTCAAATACGGATATGTATTTCCAAAAACAAACAAACTTAAAAACCGACTCATACACGGATGACGTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	31.10%	0.15%	17.77%	NA
All Indica	2759	66.70%	2.90%	0.22%	30.23%	NA
All Japonica	1512	34.30%	65.60%	0.07%	0.07%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	56.50%	0.20%	0.34%	43.03%	NA
Indica II	465	91.20%	2.60%	0.00%	6.24%	NA
Indica III	913	55.50%	3.70%	0.22%	40.53%	NA
Indica Intermediate	786	72.90%	4.10%	0.25%	22.77%	NA
Temperate Japonica	767	58.50%	41.30%	0.13%	0.00%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	22.80%	76.80%	0.00%	0.41%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	52.20%	42.20%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608135057	A -> G	LOC_Os06g14470.1	upstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:18.661; most accessible tissue: Callus, score: 48.82	N	N	N	N
vg0608135057	A -> G	LOC_Os06g14470.2	upstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:18.661; most accessible tissue: Callus, score: 48.82	N	N	N	N
vg0608135057	A -> G	LOC_Os06g14470-LOC_Os06g14480	intergenic_region ; MODIFIER	silent_mutation	Average:18.661; most accessible tissue: Callus, score: 48.82	N	N	N	N
vg0608135057	A -> DEL	N	N	silent_mutation	Average:18.661; most accessible tissue: Callus, score: 48.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608135057	NA	5.96E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.25E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.49E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	2.54E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	7.18E-06	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	3.14E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.58E-25	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.86E-22	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	3.19E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.20E-10	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	3.22E-29	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.64E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	2.89E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.98E-07	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.42E-07	mr1331_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	4.36E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	3.02E-06	1.40E-29	mr1551_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.13E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	6.07E-21	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	2.85E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	5.34E-14	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	2.37E-16	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	1.76E-40	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	7.98E-12	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	2.39E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	7.83E-06	NA	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	2.11E-07	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	2.65E-06	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	8.83E-32	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	4.80E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608135057	NA	4.80E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251