\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608120267:

Variant ID: vg0608120267 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 8120267
Reference Allele: AAlternative Allele: G,ATAACGAATCTGTATAGTCTTTTATTTAGATTTGTTG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGCACATCTTCTCGAGCCTGTATTGGAAGTAAAAAATCAAATCTACGTGATTAGATCTTAATATAACGAATCTGTATAGTATTTTGTTTAGATTTGTT[A/G,ATAACGAATCTGTATAGTCTTTTATTTAGATTTGTTG]
TACTAGAATGAATCATTCTCTTATTCAGATTCGTTATAATAAGATGTATCAAATCACATACTAGATTTGTTTTTATGAGATGGATAAAGTATCCCCTCCG

Reverse complement sequence

CGGAGGGGATACTTTATCCATCTCATAAAAACAAATCTAGTATGTGATTTGATACATCTTATTATAACGAATCTGAATAAGAGAATGATTCATTCTAGTA[T/C,CAACAAATCTAAATAAAAGACTATACAGATTCGTTAT]
AACAAATCTAAACAAAATACTATACAGATTCGTTATATTAAGATCTAATCACGTAGATTTGATTTTTTACTTCCAATACAGGCTCGAGAAGATGTGCAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 28.50% 0.28% 0.00% ATAACGAATCTGTATAGTCTTTTATTTAGATTTGTTG: 0.08%
All Indica  2759 98.40% 1.60% 0.04% 0.00% NA
All Japonica  1512 19.20% 79.90% 0.66% 0.00% ATAACGAATCTGTATAGTCTTTTATTTAGATTTGTTG: 0.26%
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.50% 1.40% 0.11% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 32.10% 67.40% 0.52% 0.00% NA
Tropical Japonica  504 3.20% 95.60% 0.40% 0.00% ATAACGAATCTGTATAGTCTTTTATTTAGATTTGTTG: 0.79%
Japonica Intermediate  241 11.60% 86.70% 1.66% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608120267 A -> G LOC_Os06g14450.1 downstream_gene_variant ; 417.0bp to feature; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N
vg0608120267 A -> G LOC_Os06g14450.2 downstream_gene_variant ; 422.0bp to feature; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N
vg0608120267 A -> G LOC_Os06g14450.3 downstream_gene_variant ; 422.0bp to feature; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N
vg0608120267 A -> G LOC_Os06g14450-LOC_Os06g14460 intergenic_region ; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N
vg0608120267 A -> ATAACGAATCTGTATAGTCTTTTATTTAGA TTTGTTG LOC_Os06g14450.1 downstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N
vg0608120267 A -> ATAACGAATCTGTATAGTCTTTTATTTAGA TTTGTTG LOC_Os06g14450.2 downstream_gene_variant ; 423.0bp to feature; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N
vg0608120267 A -> ATAACGAATCTGTATAGTCTTTTATTTAGA TTTGTTG LOC_Os06g14450.3 downstream_gene_variant ; 423.0bp to feature; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N
vg0608120267 A -> ATAACGAATCTGTATAGTCTTTTATTTAGA TTTGTTG LOC_Os06g14450-LOC_Os06g14460 intergenic_region ; MODIFIER silent_mutation Average:76.941; most accessible tissue: Callus, score: 90.248 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608120267 A ATAAC* 0.07 -0.11 0.02 0.03 -0.06 -0.11
vg0608120267 A G -0.01 -0.02 0.0 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608120267 NA 1.11E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 1.85E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 1.62E-29 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 7.15E-28 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 3.40E-07 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 2.84E-07 NA mr1517_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 1.08E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 3.39E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 4.99E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 5.74E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 1.50E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608120267 NA 1.62E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251