Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608111689:

Variant ID: vg0608111689 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8111689
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTGAGAAAAAACTATATGTTTGTTATATTTTTAGTATAAATTCTGAAGGATAAAAATTACTATATGACCTGAACGGCCACGTCCTCGTCGTCCTGA[A/G]
CTAATAAAACCGAAAAGCCAAGACACAGATTGATCACGACACGCTGATGTGCCGCGATTAGCGAGTGGCTGTCACATATCCGGAGATGAGATAATCAACA

Reverse complement sequence

TGTTGATTATCTCATCTCCGGATATGTGACAGCCACTCGCTAATCGCGGCACATCAGCGTGTCGTGATCAATCTGTGTCTTGGCTTTTCGGTTTTATTAG[T/C]
TCAGGACGACGAGGACGTGGCCGTTCAGGTCATATAGTAATTTTTATCCTTCAGAATTTATACTAAAAATATAACAAACATATAGTTTTTTCTCAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 42.60% 0.44% 5.61% NA
All Indica  2759 65.80% 33.20% 0.25% 0.80% NA
All Japonica  1512 34.00% 65.50% 0.33% 0.13% NA
Aus  269 2.60% 7.40% 2.60% 87.36% NA
Indica I  595 55.50% 44.00% 0.17% 0.34% NA
Indica II  465 90.80% 8.80% 0.22% 0.22% NA
Indica III  913 54.10% 45.00% 0.22% 0.66% NA
Indica Intermediate  786 72.40% 25.60% 0.38% 1.65% NA
Temperate Japonica  767 58.50% 41.30% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.00% 0.40% 0.20% NA
Japonica Intermediate  241 22.00% 76.80% 0.83% 0.41% NA
VI/Aromatic  96 50.00% 46.90% 0.00% 3.12% NA
Intermediate  90 47.80% 46.70% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608111689 A -> G LOC_Os06g14450.1 upstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:88.636; most accessible tissue: Minghui63 flag leaf, score: 99.392 N N N N
vg0608111689 A -> G LOC_Os06g14450.2 upstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:88.636; most accessible tissue: Minghui63 flag leaf, score: 99.392 N N N N
vg0608111689 A -> G LOC_Os06g14450.3 upstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:88.636; most accessible tissue: Minghui63 flag leaf, score: 99.392 N N N N
vg0608111689 A -> G LOC_Os06g14440-LOC_Os06g14450 intergenic_region ; MODIFIER silent_mutation Average:88.636; most accessible tissue: Minghui63 flag leaf, score: 99.392 N N N N
vg0608111689 A -> DEL N N silent_mutation Average:88.636; most accessible tissue: Minghui63 flag leaf, score: 99.392 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608111689 A G -0.04 0.04 0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608111689 NA 3.14E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.94E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 4.12E-07 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 2.38E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 5.14E-10 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 4.92E-06 4.92E-06 mr1046_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 2.03E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.98E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 2.39E-06 NA mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.58E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 2.07E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.42E-07 mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.75E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 7.99E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 3.73E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 9.79E-07 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 4.07E-06 NA mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 6.82E-06 6.81E-06 mr1487_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 8.57E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 7.53E-06 NA mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.13E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.66E-15 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 7.91E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 7.70E-09 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 2.85E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 2.38E-08 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.29E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 1.03E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 7.06E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 3.18E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 2.39E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 4.01E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 NA 5.90E-06 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608111689 5.20E-07 4.66E-09 mr1982_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251