Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0608096553:

Variant ID: vg0608096553 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8096553
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCGGCGGCAGCGGCGGTTTGGCGGCGTCATCACCACCGGACGACGTGGGGCGCCGGATCTCCTTCAACAGCGCGACGATCTTTCGTTGGCAACTTTTT[G/A]
TGACAAGTTGACAAACACGATCGCAGCAGAGGACGGGGAAGAGGACGGGGGCGGCAGCGGTGGCTGGCGCACGAAGGGAAGAGGAGGCGCCGGCGACACG

Reverse complement sequence

CGTGTCGCCGGCGCCTCCTCTTCCCTTCGTGCGCCAGCCACCGCTGCCGCCCCCGTCCTCTTCCCCGTCCTCTGCTGCGATCGTGTTTGTCAACTTGTCA[C/T]
AAAAAGTTGCCAACGAAAGATCGTCGCGCTGTTGAAGGAGATCCGGCGCCCCACGTCGTCCGGTGGTGATGACGCCGCCAAACCGCCGCTGCCGCCGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 42.10% 0.08% 0.00% NA
All Indica  2759 67.40% 32.50% 0.11% 0.00% NA
All Japonica  1512 34.50% 65.50% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 55.60% 44.20% 0.17% 0.00% NA
Indica II  465 91.20% 8.80% 0.00% 0.00% NA
Indica III  913 56.70% 43.20% 0.11% 0.00% NA
Indica Intermediate  786 74.70% 25.20% 0.13% 0.00% NA
Temperate Japonica  767 58.70% 41.30% 0.00% 0.00% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 23.70% 76.30% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608096553 G -> A LOC_Os06g14440.1 upstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:90.693; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0608096553 G -> A LOC_Os06g14440.3 upstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:90.693; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0608096553 G -> A LOC_Os06g14440.4 upstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:90.693; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0608096553 G -> A LOC_Os06g14430-LOC_Os06g14440 intergenic_region ; MODIFIER silent_mutation Average:90.693; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608096553 G A 0.02 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608096553 NA 2.09E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 4.71E-06 1.90E-11 mr1030_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 8.45E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 1.98E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 5.01E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 1.42E-07 mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 4.80E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 4.75E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 7.77E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 9.62E-06 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 7.31E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 1.13E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 3.69E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 8.07E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 7.05E-09 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 2.85E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 5.43E-08 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 3.11E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 1.34E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 6.16E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 3.32E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 2.20E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 2.39E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 7.65E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 NA 2.57E-07 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608096553 6.80E-06 6.63E-08 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251