RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0608085803:

Variant ID: vg0608085803 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8085803
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTGGTGTGATATATGATTGATATCATGAGTGCCCTACCTCAATCCATTTATCAACTTTATATATATATATATATATATATATATATGCACGATTGA[C/T]
TAGTCCATGATTTGCCTGTTAATTGCGTCTGTTTTTTTTATATATTTAAGGATGATTTTATAGCTCTTGACTGAAGCAACAGAGAACCACCACATTGTAT

Reverse complement sequence

ATACAATGTGGTGGTTCTCTGTTGCTTCAGTCAAGAGCTATAAAATCATCCTTAAATATATAAAAAAAACAGACGCAATTAACAGGCAAATCATGGACTA[G/A]
TCAATCGTGCATATATATATATATATATATATATATATAAAGTTGATAAATGGATTGAGGTAGGGCACTCATGATATCAATCATATATCACACCAAAAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	10.60%	0.55%	23.47%	NA
All Indica	2759	98.30%	0.10%	0.11%	1.45%	NA
All Japonica	1512	1.90%	32.50%	0.86%	64.75%	NA
Aus	269	93.30%	0.00%	0.00%	6.69%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.40%	0.00%	0.00%	2.58%	NA
Indica III	913	98.40%	0.00%	0.11%	1.53%	NA
Indica Intermediate	786	97.80%	0.10%	0.25%	1.78%	NA
Temperate Japonica	767	1.60%	57.40%	0.26%	40.81%	NA
Tropical Japonica	504	1.60%	1.00%	0.99%	96.43%	NA
Japonica Intermediate	241	3.30%	19.50%	2.49%	74.69%	NA
VI/Aromatic	96	54.20%	0.00%	1.04%	44.79%	NA
Intermediate	90	53.30%	4.40%	10.00%	32.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608085803	C -> T	LOC_Os06g14430-LOC_Os06g14440	intergenic_region ; MODIFIER	silent_mutation	Average:69.19; most accessible tissue: Callus, score: 96.618	N	N	N	N
vg0608085803	C -> DEL	N	N	silent_mutation	Average:69.19; most accessible tissue: Callus, score: 96.618	N	N	N	N

Showing 1 to 2 of 2 entries

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Show entries

Search:

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0608085803	C	T	-0.18	-0.03	-0.04	0.0	-0.02	-0.01

Showing 1 to 1 of 1 entries

Previous1Next

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608085803	1.34E-07	1.17E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	NA	1.65E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	NA	7.83E-06	mr1331_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	NA	1.34E-06	mr1331_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	NA	4.02E-08	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	7.52E-08	NA	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	NA	2.44E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	2.90E-08	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608085803	9.76E-07	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0608085803:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Effects Predicted by Deep Convolutional Neural Networks

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact