Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608080641:

Variant ID: vg0608080641 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8080641
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCATCAAATGTTCTTTAAGCATGACATAAATATTTTTCATATTTGCATAAAAATTTTGAATAAAACGAATGGCCAAACGTTAGTCGAAAAGTCAACGGC[G/A]
TCATACATTAAAATACTACGGAGGGAGTATATTTTTTTTTACTACCAACCAACAGTTATCTCCATCACTTGTTGGTTGTCTTCGTTGTCGTTGGAGCGTC

Reverse complement sequence

GACGCTCCAACGACAACGAAGACAACCAACAAGTGATGGAGATAACTGTTGGTTGGTAGTAAAAAAAAATATACTCCCTCCGTAGTATTTTAATGTATGA[C/T]
GCCGTTGACTTTTCGACTAACGTTTGGCCATTCGTTTTATTCAAAATTTTTATGCAAATATGAAAAATATTTATGTCATGCTTAAAGAACATTTGATGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 30.40% 3.64% 0.99% NA
All Indica  2759 90.40% 2.10% 5.87% 1.67% NA
All Japonica  1512 16.10% 83.50% 0.33% 0.07% NA
Aus  269 91.40% 8.20% 0.37% 0.00% NA
Indica I  595 95.00% 0.30% 4.37% 0.34% NA
Indica II  465 80.40% 3.40% 10.11% 6.02% NA
Indica III  913 93.00% 1.80% 4.93% 0.33% NA
Indica Intermediate  786 89.70% 3.10% 5.60% 1.65% NA
Temperate Japonica  767 26.50% 73.00% 0.39% 0.13% NA
Tropical Japonica  504 0.80% 99.00% 0.20% 0.00% NA
Japonica Intermediate  241 15.40% 84.20% 0.41% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 45.60% 50.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608080641 G -> A LOC_Os06g14430.1 upstream_gene_variant ; 3700.0bp to feature; MODIFIER silent_mutation Average:89.099; most accessible tissue: Zhenshan97 flag leaf, score: 97.773 N N N N
vg0608080641 G -> A LOC_Os06g14430-LOC_Os06g14440 intergenic_region ; MODIFIER silent_mutation Average:89.099; most accessible tissue: Zhenshan97 flag leaf, score: 97.773 N N N N
vg0608080641 G -> DEL N N silent_mutation Average:89.099; most accessible tissue: Zhenshan97 flag leaf, score: 97.773 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608080641 G A 0.0 -0.04 -0.06 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608080641 NA 1.90E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608080641 NA 5.47E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608080641 NA 1.72E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608080641 NA 4.05E-11 mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608080641 NA 2.23E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608080641 NA 1.23E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608080641 NA 2.43E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608080641 NA 4.12E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251